Aplochiton marinus

Eigenmann, 1928 · species

image placeholder — illustration coming later

Animalia/Chordata/Osmeriformes/Galaxiidae/Aplochiton

At a glance

Occurrence records23

Data sources9

Biological traits4

DNA specimens3

eDNA detections23

Sources9 archives

Databases and archives Aplochiton marinus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 records↗

OBISOcean Biodiversity Information System6 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS23 records

Environmental DNA1 datasets · 1 countries23 detections

DNA & barcodingBOLD3 specimens

01Narrative

Aplochiton marinus is a species of fish in the family Galaxiidae. It is an amphidromous fish migrating between ocean and fresh water. A. marinus is endemic to Chile.World Conservation Monitoring Centre 1996. Aplochiton marinus. 2006 IUCN Red List of Threatened Species. Downloaded on 4 August 2007. FishBase lists A. marinus as a synonym of A. taeniatus (also reported in Argentina), but IUCN treats it as a distinct species of its own.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Habitat & environment3

Habitat brackishyes

Habitat freshwateryes

Habitat zonedemersal

Other traits1

Vulnerability27.33

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplochiton marinus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections23

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P677 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.20%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 2 variable positions, in barcode order

225Gvariable

246Cvariable

GATATTGGCACCCTATATCTAGTATTTGGTGCTTGGGCCGGCATGGTCGGCACAGCTTTAAGCCTTCTAATCCGGGCGGAGCTGAGCCAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aplochiton taeniatussame genus8.9%Aplochiton zebrasame genus9.3%Opostomias micripnussame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type23 records

Wild obs. + sensor1

Museum / vouchered13

Other9

Origin

Native9

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 9

9 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	3
Chicago, US	1

2 institutions · 4 of 13 vouchered records shown · 3 without an institution code

09Environmental DNA23 detections

Where the DNA of Aplochiton marinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 0.1–14.1

Seasonal swing summer↔winter12.4 °C

Max temp (day)20.5 °C 2.30–20.5

Min temp (night)8.70 °C -2.80–8.70

Precipitation145 mm/mo 145–426

Air humidity58.8 % 58.8–63.7

Moisture balance39.0 mm/mo 39.0–368

Vapour deficit702 Pa 273–702

Wind speed2.50 m/s 2.50–11.1

Cloud cover20.8 % 20.8–43.5

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)