Aploactis aspera

(Richardson, 1845) · species

image placeholder — illustration coming later

Animalia/Chordata/Scorpaeniformes/Aploactinidae/Aploactis

At a glance

Occurrence records315

Data sources8

Biological traits6

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Aploactis aspera's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility124 records↗

OBISOcean Biodiversity Information System191 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS315 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

The dusky velvetfish (Aploactis aspera) is a species of marine ray-finned fish, a velvetfish belonging to the family Aploactinidae. It is the only member of the monotypic genus Aploactis. This species is found in the western Pacific Ocean.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length10 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits3

Depth max10 m

Depth min1 m

Vulnerability10

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aploactis aspera has left across the world's sequence archives.

At a glance

DNA specimens3

BINs2

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P668 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.7%

Haplotypes1

BINs2

Where individuals differ — all 17 variable positions, in barcode order

77Gvariable

121Avariable

177Cvariable

204Avariable

234Tvariable

276Tvariable

345Avariable

363Avariable

411Avariable

417Cvariable

432Avariable

444Tvariable

459Cvariable

465Avariable

480Cvariable

525Avariable

594Cvariable

ACCTTATATTTAGTCTTTGGTGCCTGAGCCGGTATAGTAGGCACAGGCCTAAGCCTACTAATTCGAGCCGAACTAAGCCAACCCGGAGCC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adventor elongatussame family12.6%Inimicus didactylussame order16.2%Crossoloricaria variegatasame order16.5%Lutjanus coloradosame order17.4%Zaniolepis frenatasame order17.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type315 records

Wild obs. + sensor88

Museum / vouchered224

Other3

Origin

Native1

Range

Area of Occupancy AOO472 km²

Depth

0–200 m sunlit70

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 50 m · max 162 m · 70 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤1 km 77>10 km 3

80 georeferenced · 8 without coordinates

Open the mapobservation + sensor88

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 12≤1 km 67≤10 km 30>10 km 7

116 georeferenced · 108 without coordinates

Open the institutions mapphysical evidence224

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	29
Australian National Fish Collectionlocation not on record	26
Sydney, AU	15
Kagoshima University Museumlocation not on record	9
FishBaselocation not on record	2
Museum and Art Gallery of the Northern Territorylocation not on record	2
CASlocation not on record	2
University of California San Diegolocation not on record	2
Fisheries Research Laboratory, Mie Universitylocation not on record	1
Paris, FR	1
DEWlocation not on record	1
CSIRO, Australian National Fish Collectionlocation not on record	1
Louisiana State University, Museum of Zoologylocation not on record	1
Western Australian Museumlocation not on record	1
Chicago, US	1

15 institutions · 94 of 224 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Aploactis aspera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 21.6–22.9

Seasonal swing summer↔winter7.40 °C

Max temp (day)22.8 °C 22.7–23.9

Min temp (night)21.5 °C 20.5–21.8

Precipitation89.1 mm/mo 25.2–152

Air humidity59.9 % 59.8–63.2

Vapour deficit1,029 Pa 973–1,108

Cloud cover25.2 % 18.7–26.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)