Aplectoides condita

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Aplectoides

At a glance

Occurrence records692

Data sources7

Biological traits0

DNA specimens71

eDNA detections71

Sources7 archives

Databases and archives Aplectoides condita's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility692 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI71 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics71 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF692 records

Environmental DNA1 datasets · 2 countries71 detections

DNA & barcodingBOLD71 specimens

01Narrative

Aplectoides condita is a moth of the family Noctuidae. It is found across central and southern Canada from Newfoundland to British Columbia. In the east it occurs as far south as northern New Jersey and northern Pennsylvania, west to Michigan and Wisconsin. It is found along the Appalachians in Virginia and North Carolina. In the west it occurs in Idaho and Oregon. Recently it has also been recorded from Tennessee. The wingspan is about 33 mm. Adults are on wing from May to July. Larvae have been reared on Abies balsamea and Larix laricina. They seemed to prefer the latter.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding71 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplectoides condita has left across the world's sequence archives.

At a glance

DNA specimens71

BINs1

Marker genes1

eDNA detections71

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus68 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

40Gmostly conserved

85Cmostly conserved

133Cvariable

238Cvariable

271Tmostly conserved

368Gmostly conserved

646Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTGGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCCGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.43%

Haplotypes18

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chersotis deplanatasame family5.3%Netrocerocora quadrangulasame family5.3%Xestia plebeiasame family5.6%Xestia rhomboideasame family5.6%Rhiza commodasame family5.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type692 records

Wild obs. + sensor295

Museum / vouchered397

Range

Area of Occupancy AOO1 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 188≤1 km 29≤10 km 12>10 km 6

235 georeferenced · 60 without coordinates

Open the mapobservation + sensor295

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 27≤1 km 80≤10 km 53

160 georeferenced · 237 without coordinates

Open the institutions mapphysical evidence397

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
East Lansing, US	81
University of Alberta Museums (UAM)location not on record	67
University of Guelph, Centre for Biodiversity Genomicslocation not on record	31
New Haven, US	27
Colorado State Universitylocation not on record	27
Oregon State Arthropod Collectionlocation not on record	25
St. Paul, US	18
Royal Saskatchewan Museumlocation not on record	13
Helsinki, FI	12
Brussels, BE	9
RBINS-Scientific Heritagelocation not on record	6
UNHClocation not on record	6
Saint John, CA	3
Toronto, CA	2
WWUlocation not on record	1

15 institutions · 328 of 397 vouchered records shown · 69 without an institution code

09Environmental DNA71 detections

Where the DNA of Aplectoides condita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found71

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 71 detections have coordinates

Open the map2 countries0

WetlandGrasslandForestUrbanBeach

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 7.80–18.2

Seasonal swing summer↔winter28.3 °C

Max temp (day)20.0 °C 14.0–23.3

Min temp (night)11.0 °C 1.90–13.9

Precipitation105 mm/mo 49.5–153

Air humidity58.0 % 51.2–64.1

Moisture balance-14.3 mm/mo -70.0–19.9

Vapour deficit733 Pa 500–892

Wind speed2.30 m/s 1.70–5.20

Cloud cover44.6 % 36.1–49.7

CHELSA 1981–2010, ~9 km grid, at location & month of 70 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)