Aplasta ononaria

(Füssly, 1783) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Aplasta

At a glance

Occurrence records2 825

Data sources9

Biological traits2

DNA specimens34

eDNA detections14

Sources9 archives

Databases and archives Aplasta ononaria's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 825 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 825 records

Environmental DNA1 datasets · 6 countries14 detections

DNA & barcodingBOLD34 specimens

Genome at a glanceGoaT · NCBI≈284 Mbp

01Narrative

Aplasta is a monotypic moth genus in the family Geometridae erected by Jacob Hübner in 1823. Its only species, Aplasta ononaria, the rest harrow, was first described by Johann Kaspar Füssli in 1783. It is found in southern Europe to Anatolia and from England to the Baltic states. The wingspan is 26–31 mm. The length of the forewings 13–14 mm. The moth flies from June to September depending on the location. The larvae feed on Ononis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplasta ononaria has left across the world's sequence archives.

At a glance

DNA specimens34

BINs4

Marker genes14

eDNA detections14

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

31Amostly conserved

34Avariable

40Amostly conserved

46Tvariable

85Amostly conserved

100Gvariable

157Tvariable

181Amostly conserved

206Tvariable

220Avariable

232Cmostly conserved

235Tvariable

274Cvariable

294Tvariable

304Tmostly conserved

316Avariable

343Cmostly conserved

346Tvariable

347Cmostly conserved

364Cvariable

373Cvariable

400Avariable

406Tmostly conserved

412Amostly conserved

424Gvariable

433Gmostly conserved

469Amostly conserved

479Tmostly conserved

487Cvariable

514Tmostly conserved

547Tmostly conserved

548Cmostly conserved

565Avariable

568Tvariable

571Tvariable

589Tvariable

622Amostly conserved

625Amostly conserved

628Gvariable

649Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTACTAATTCGAGCTGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes8

BINs4

Most divergent pair3.8%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Oxydia sociatasame family7.9%Coenina tergimaculasame family8.2%Eutelia fulvigriseasame order8.4%Melanolophia bostarsame family8.5%Melanolophia imperfectariasame family8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5Patp6ATP8COIICOXIIICYTBND1ND2ND3ND4ND4LND6EF1-alphaMT-NADH5

animal barcodemitochondrialmarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aplasta ononaria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈283 888 888 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aplasta ononaria0.28 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.6% BUSCO

08Occurrence & distribution

Record type2 825 records

Wild obs. + sensor2 166

Museum / vouchered623

Other36

Origin

Native105

Range

Area of Occupancy AOO4 028 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 524≤1 km 155≤10 km 990>10 km 25

1 694 georeferenced · 472 without coordinates

Open the mapobservation + sensor2 166

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 52≤1 km 29≤10 km 176>10 km 5

262 georeferenced · 361 without coordinates

Open the institutions mapphysical evidence623

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	297
Zürich, CH	91
Naturama Aargaulocation not on record	48
Geneva, CH	33
Durban Natural Science Museumlocation not on record	16
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	13
DanishLepidopterologicalSocietylocation not on record	10
Museum für Naturkunde und Vorgeschichte Dessaulocation not on record	9
Nijmegen, NL	8
Provincia di Livornolocation not on record	6
Tartu, EE	6
ZSMlocation not on record	5
Muzeum Górnośląskie w Bytomiulocation not on record	5
Archäologie und Museum Baselland - Museum.BLlocation not on record	5
Adam Mickiewicz University in Poznańlocation not on record	5
Museum zu Allerheiligen Schaffhausenlocation not on record	4
Glarus, CH	4
Naturmuseum Oltenlocation not on record	4
Paro, BT	3
SFRAlocation not on record	3
Philadelphia, US	2
Naturmuseum Solothurnlocation not on record	2
Fribourg, CH	2
Bavarian State Collection of Zoologylocation not on record	2
ZMAAlocation not on record	2
Natural History Museum Rotterdamlocation not on record	1
Research Collection of Joerg Gelbrechtlocation not on record	1
Research Collection of Gabriele Fiumilocation not on record	1
Natural History Museum, Londonlocation not on record	1

29 institutions · 589 of 623 vouchered records shown · 34 without an institution code

09Environmental DNA14 detections

Where the DNA of Aplasta ononaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 15.2–21.2

Seasonal swing summer↔winter17.3 °C

Max temp (day)21.3 °C 18.1–25.5

Min temp (night)12.7 °C 10.5–16.6

Precipitation59.5 mm/mo 6.10–83.9

Air humidity57.2 % 49.3–61.9

Moisture balance-60.8 mm/mo -180–-37.0

Vapour deficit854 Pa 700–1,211

Wind speed3.30 m/s 2.40–4.10

Cloud cover36.4 % 23.1–38.4

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aplasta ononaria

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 825 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 825 records