Apium prostratum

Labill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Apium

At a glance

Occurrence records1 828

Data sources10

Biological traits50

DNA specimens5

eDNA detections11

Sources10 archives

Databases and archives Apium prostratum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 828 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources50 traits

Occurrence & distributionGBIF1 828 records

Environmental DNA1 datasets · 4 countries11 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Apium prostratum, le Faux persil de Corniche, est une espèce de plantes à fleurs de la famille des Apiaceae et du genre Apium. C'est une plante herbacée commune sur les côtes maritimes des pays subtropicaux, tempérés et froids de l’hémisphère Sud, notamment en Patagonie, au sud de l'Australie et en Nouvelle-Zélande. C'est une ombellifère très proche du céleri. Sa comestibilité est connue depuis le XVIe siècle des marins explorateurs européens. Son usage fut notamment salutaire pour lutter contre le scorbut lors des grandes traversées des océans. C'est une plante aux ombelles blanches qui présente un port érigé ou étalé, est aromatique, charnue et ornée de feuilles pennées aux pétioles souvent violacés.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology21

Fruit length2 mm

Fruit length max2.5 mm

Fruit length min1.5 mm

Fruit width2 mm

⚠ sources differ — AusTraits: 2 mm · GIFT: 3 mm

Fruit width max2.5 mm

Fruit width min1.5 mm

Leaf length45.5 mm

Leaf length max700 mm

Leaf length min15 mm

Leaf size2 067 mm²

Leaf width10 mm

Leaf width max30 mm

Leaf width min2 mm

Plant height0.2 m

Plant height max1 m

Plant height min0.05 m

Seed length1.5 mm

Seed mass0.996 mg

⚠ sources differ — TRY: 0.996 mg · AusTraits: 1.46 mg · GIFT: 1.3 mg

Seed mass max1.31 mg

Seed mass min1.29 mg

Seed width0.8 mm

Life cycle & reproduction12

Deciduousnessevergreen

Dispersal typeanimal

⚠ sources differ — AusTraits: zoochory · GIFT: unspecialized

Flowering endApr

Flowering startOct

Flowering timennnnnnnnyyyn

Life formbiennial or perennial

Life spanbiennial perennial

⚠ sources differ — AusTraits: biennial perennial · GIFT: perennial

Pollination syndromeinsect

Raunkiær life formtherophyte

Reproduction asexualpresent

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max914 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formherb

Habitat GIFTCoastal

Leaf compoundnesscompound

Leaf shapelanceolate linear obovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apium prostratum has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences8

eDNA detections11

Countries4

The DNA barcodea real sequence read deposited for this species

ITSGQ379298.1 ↗596 bpNew Zealand

ACGT

TCGAATCCTGCGACAGCAGAATGACCCGCTAACACGTAAACACATTGGGCAAGCGTCGGTGGGCTTTGGTCCGCCGTTTGCAAACCTTTG …

Apium prostratum voucher Bartlett s.n. VIII-1977 (CHR) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS7★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Apium prostratum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 224×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants · CCDB · Cave1963

CCDB · book-fedorov — Beuzonberg, Hair 1963

CCDB · book-fedorov — Bell, Constance 1966

CCDB · book-atlas-flowering-plants — Whitaker 1941

CCDB · Cave1963 — Beuzen. & Hair 1963

2n 331×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

n 114×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +1

CCDB · ipcn-api-dl — Constance, L., T. i. Chuang & C. R. Bell. 1976. Chromosome numbers in Umbelliferae. V. Amer. J. Bot. 63(5): 608–625.

CCDB · book-ipcn66 — Bell & Constance 1966

CCDB · book-ipcn67-71 — KORDYUM, E. L. 1967. Cyto-embryology of Umbellates. (In Russian). Naukova Dumka, Kiev, 1967, 128pp.

CCDB · Cave1963 — Beuzen. & Hair 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 828 records

Wild obs. + sensor1 771

Museum / vouchered57

Range

Area of Occupancy AOO4 116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 1 022≤1 km 190≤10 km 47>10 km 41

1 300 georeferenced · 471 without coordinates

Open the mapobservation + sensor1 771

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 17

17 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	13
San Jose State University, Museum of Birds and Mammalslocation not on record	7
Valparaiso, CL	5
Honolulu, US	5
Museo Entomologico de Leonlocation not on record	4
Paris, FR	4
Wellington, NZ	3
San Isidro, AR	3
UFMGlocation not on record	2
Stockholm, SE	1
Claremont, US	1
Viña del Mar, CL	1
Saint Louis, US	1
South Kensington, GB	1
BISHlocation not on record	1
Universidade Federale do Rio Grande do Sullocation not on record	1

16 institutions · 53 of 57 vouchered records shown

09Environmental DNA11 detections

Where the DNA of Apium prostratum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 5.70–18.8

Seasonal swing summer↔winter15.6 °C

Max temp (day)21.8 °C 9.20–26.6

Min temp (night)11.5 °C 1.40–11.7

Precipitation66.4 mm/mo 34.5–145

Air humidity54.7 % 48.3–62.6

Moisture balance-49.9 mm/mo -98.6–54.3

Vapour deficit875 Pa 357–1,186

Wind speed2.90 m/s 2.50–5.90

Cloud cover20.8 % 16.3–38.9

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apium prostratum

At a glance

Sources10 archives

Size & morphology21

Life cycle & reproduction12

Diet & foraging1

Habitat & environment13

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 828 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 828 records