Apium graveolens
speciesAt a glance
Occurrence records22 838
Data sources17
Biological traits65
DNA specimens37
eDNA detections55
Sources17 archives
Databases and archives Apium graveolens's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility22 808 records↗
OBISOcean Biodiversity Information System30 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI55 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics37 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
foodatlascompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources65 traits
Chemical compositionFooDB · FoodAtlas · LOTUS · NPASS6 423 compounds
Occurrence & distributionGBIF · OBIS22 838 records
Environmental DNA4 datasets · 9 countries55 detections
DNA & barcodingBOLD · NCBI37 specimens
Genome at a glanceCCDB · GoaT · NCBI≈3.3 Gbp
01Narrative
Le céleri ou cèleri ou ache des marais ou encore persil des marais, est une espèce de plantes à fleurs de la famille des Apiacées. C'est une plante herbacée bisannuelle originaire d'Europe cultivée comme plante potagère pour ses feuilles et sa racine tubérisée consommées comme légumes.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology22
Fruit length1.5 mm
⚠ sources differ — AusTraits: 1.5 mm · GIFT: 1.75 mm
Fruit length max2 mm
Fruit length min1.5 mm
Fruit width1 mm
⚠ sources differ — AusTraits: 1 mm · GIFT: 1.75 mm
Fruit width max2 mm
Fruit width min1.5 mm
Leaf length40 mm
Leaf length max50 mm
Leaf length min10 mm
Leaf mass404 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 6 432 mm² · GIFT: 6 432 mm²
Leaf width28 mm
Plant height0.567 m
⚠ sources differ — GIFT: 0.567 m · AusTraits: 1 m · LEDA: 0.5 m · TRY: 0.844 m
Plant height generative0.65 m
Plant height max1.3 m
Plant height min0.3 m
Seed length1.5 mm
Seed length max1.5 mm
Seed length min1.5 mm
Seed mass0.394 mg
⚠ sources differ — TRY: 0.394 mg · LEDA: 0.453 mg · GIFT: 0.409 mg
Seed mass max0.67 mg
Seed mass min0.032 mg
Life cycle & reproduction17
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typehuman
⚠ sources differ — LEDA: ethelochor · GIFT: hydrochorous
Flower colourwhite
Flower length max0.5 mm
Flowering endSep
Flowering startJul
Flowering timennnnnnnnnnyn
Life formbiennial
Life spanstrict monocarpic bi-annuals and poly-annuals
⚠ sources differ — TRY: strict monocarpic bi-annuals and poly-annuals · AusTraits: biennial · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: biennial
Lifespan years1.5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Seed number380
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit typemericarp
Growth formherb
Habitat GIFT?
Leaf compoundnesscompound
Leaf formpinnate
Leaf shapeobtriangular ovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)167 mg/g
Photosynthetic pathwayC3
Seed longevity index1
Specific leaf area (SLA)18.2 mm²/mg
Other traits6
Diaspore typeone-seeded generative dispersule
Inflorescenceumbel
Monocarpymonocarp
Plant support typefree-standing
Seeds per fruit101-1000
Shoot orientationerect
03Chemical composition6 423 compounds
Compounds documented for Apium graveolens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingHerbs and Spices
Compound class profile5 classes
Aminoacids170
Flavones64
Cinnamic acids and derivatives59
Glycerophospholipids57
Unsaturated fatty acids49
Documented compounds6 423 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| WATER | 95,200 mg/100g | FoodAtlas | |
| Sugars | 35,900 mg/100g | FooDB | |
| beta-Selinene | 19,000 mg/100g | FooDB | |
| Elaidic acid | 15,450 mg/100g | FooDB | |
| protein polypeptide chain | 9,350 mg/100g | FoodAtlas | |
| Potassium | 4,388 mg/100g | FooDB | |
| (Z,Z)-9,12-Octadecadienoic acid | 3,645.1 mg/100g | FooDB |
05DNA & barcoding37 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apium graveolens has left across the world's sequence archives.
At a glance
DNA specimens37
Marker genes6
GenBank sequences10
eDNA detections55
Countries9
The DNA barcodea real sequence read deposited for this species
GGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCAATAGGCCGAGGGCACGTCTGCCTGGGTGTC …
Apium graveolens voucher PS0319MT01 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL5★rbcLa★ITS5★ITS2
animal barcodeplant barcodefungal barcode
Organelle genome
Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.
▸ Tap any coloured segment — or a gene chip — to see what it is
Mitochondrion
NC_058313 ↗ · 140 protein · 26 tRNA · 5 rRNA
nad2orf199aorf143arpl16rps3orf121borf109brpl5ccmCorf159aatp1nad4orf109aorf103aorf139aorf112aorf142aorf133borf129aorf160anad3rps12orf104arps13orf148aorf118a+76
Pick a coloured segment on the ring — or a gene chip — to read what that gene does.
protein-codingrRNAtRNA
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Apium graveolens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size≈3 332 577 507 bp assembly estimate
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Apium graveolens3.33 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 22 n = 11
Ploidydiploid inferred
Chromosome records22–222n range22median22mode62records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2262×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · slov-fl +12
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ita-fl — PAVONE P., TERRASI M.C., ZIZZA A. - 1981. Chromosome number reports LXXII.. Taxon , 30(3): 695-696.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. Queirs, M.Anurio Soc. Brot.38: 293(1972).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. VII. Umbelliferae, supl. 1. Queirs, M.Bol. Soc. Brot. ser. 248: 171-186(1974).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3283
CCDB · ipcn-api-dl — Li, R. q. 1989. Studies on Karyotypes of Vegetables in China
CCDB · ipcn-api-dl — Hamal, I. A., A. LANGER & A. K. Koul. 1986. Nucleolar organizing region in the Apiaceae (Umbelliferae). Pl. Syst. Evol. 154: 11–30.
CCDB · ipcn-api-dl — Das, A. B. & R. Mallick. 1985. Karyotype study in Apium graveolens L., Daucus carota L. and Hydrocotyle asiatica L. Proc. Indian Sci. Congr. Assoc. 73(3–VI): 126.
CCDB · ipcn-api-dl — Geldykhanov, A. M. 1986. Chromosome numbers in some species of the family Apiaceae from Turkmenia. Bot. Zhurn. 71: 1144.
CCDB · ipcn-api-dl — Chen, R. y. 1988. G-Band staining of chromosomes in some higher plants with special reference to Lilium davidii. Kromosomo 50: 1635–1651.
CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Ahmad, I. & A. K. Koul. 1980. In Chromosome number reports LXVIII. Taxon 29: 543.
CCDB · ipcn-api-dl — Queiros, M. 1974a. Contribucao para o conhecimento citotaxonomico das Spermatophyta de Portugal. VII. Umbelliferae, Supl. 1. Bol. Soc. Brot., sér. 2 48: 171–186.
CCDB · ipcn-api-dl — Queiros, M. 1978. Numeros cromosomicos para a flora Portuguesa 1-15. Bol. Soc. Brot., sér. 2 52: 69–77.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · ipcn-api-dl — HINDAKOVA, M. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Chen, R. y. 1989. A further research of plant chromosome G-banding. Pp. 187--193 in D. Hong (editor), Plant Chromosome Research 1987.
CCDB · book-ipcn67-71 — ENGSTRAND, L. 1970. Studies in the Aegean flora XVIII. Notes and chromosome numbers in Aegean Umbelliferae. Bot. Notiser 123: 384-393.
CCDB · book-ipcn73-74 — QUEIROS, M. 1972. Contribuicao ao conhecimento citotaxonomico das Spermatophyta de Portugal. VII Umbelliferae. Anuario Soc. Brot. 38: 293-314.
CCDB · book-indian_vol1 — Emsweller, S.L. 1928; Wanscher, J.H. 1931, 1932; Hosono & Takahashi (Kihara, H. et at. 1931); Tamamshjan, S. (Fedorov); Tischler, G. 1934; Wulff, H.D. 1937a; Whitaker, T.W. 1941 ; Suzuka, O. & Koriba, S. 1949 ; Shah, G.L. 1953 ; Garde, A. & Malheims- Garde, N. 1954 ; Hiroe, M. 1955 ; Mitsukuri, Y. & Kurahori, Y. 1959 ; Sharma, A.K. & Bhattacharyya, N.K. 1959b ; Kordyum, E.L. 1967 ; Engstrand, L. 1970; Hore, A. 1971, 1977a; Cons- tance, L. et at. 1976 ; Ahmad, I. & Koul, A.K. 1980
CCDB · book-fedorov — Emsweller 1928
CCDB · book-fedorov — IT. 'i!J35-1!J36)
CCDB · book-fedorov — Wanscher 1931, 1932
CCDB · book-fedorov — Hosono. Takahashi
CCDB · book-fedorov — Kihara eL al. 1931)
CCDB · book-fedorov — TaMaMlliJIH 1933
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Wulff 1937a
CCDB · book-fedorov — Whitaker 1941
CCDB · book-fedorov — Suzuka, Koriba 1949
CCDB · book-fedorov — L. 1961)
CCDB · book-fedorov — Shah G. L. 1953
CCDB · book-fedorov — Garde, Maiheiros-Garde 1954
CCDB · book-fedorov — Hiroc 1955
CCDB · book-fedorov — Mitsukuri, Kurahori 1959
CCDB · book-fedorov — Sharma A. K., Bhattacharyya N. K. 1959b
CCDB · book-atlas-flowering-plants — Shah 1953
+22 more references
2n 214×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Murata, J. 1983. Arisaema aprile (Araceae), a new species from Honshu, Japan. J. Jap. Bot. 58: 29–32.
CCDB · ipcn-api-dl — MARKS, G. E. 1978. The consequences of an unusual Robertsonian translocation in celery (Apium graveolens var. dulce). Chromosoma 69: 211–218.
CCDB · CromoCat 2015 — Marks, G. E. (1978). The consequences of an unusual Robertsonian translocation in celery (Apium graveolens var. dulce) Chromosoma 69: 211–218
CCDB · CromoCat 2015 — Murata, J. (1983). Arisaema aprile (Araceae), a new species from Honshu, Japan. J. Jap. Bot. 58: 29–32
2n 231×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Pavone, P., C. M. Terrasi & A. Zizza. (1981b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXII]. Taxon 30(3): 695-696.
n 113×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Constance, L., T. i. Chuang & C. R. Bell. 1976. Chromosome numbers in Umbelliferae. V. Amer. J. Bot. 63(5): 608–625.
CCDB · CromoCat 2015 — Constance, L. & Chuang, T. I. (1982). Chromosome numbers of Umbelliferae (Apiaceae) from Africa south of the Sahara. Bot. J. Linn. Soc. 85: 195-208.
CCDB · CromoCat 2015 — Constance, L., Chuang, T. & Bell, C. R. (1976). Chromosome numbers in Umbelliferae. V. Amer. J. Bot. 63(5): 608-625.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
08Occurrence & distribution
Record type22 838 records
Wild obs. + sensor20 038
Museum / vouchered2 643
Cultivated / captive71
Other86
Origin
Native2 893
Introduced476
Range
Area of Occupancy AOO37 456 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy48% within 1 km
≤100 m 4 685≤1 km 3 620≤10 km 8 856>10 km 137
17 298 georeferenced · 2 740 without coordinates
Open the mapobservation + sensor20 038
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy52% within 1 km
≤100 m 172≤1 km 411≤10 km 486>10 km 48
1 117 georeferenced · 1 526 without coordinates
Open the institutions mapphysical evidence2 643
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy4% within 1 km
≤1 km 2≤10 km 33>10 km 19
54 georeferenced · 17 without coordinates
Open the mapnot free-living71
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions151 of 265 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| San Diego, US | 153 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 125 |
| LDlocation not on record | 123 |
| MeiseBGlocation not on record | 86 |
| Claremont, US | 85 |
| Pretoria, ZA | 69 |
| Adelaide, AU | 69 |
| Santa Barbara, US | 62 |
| Riverside, US | 57 |
| BIO-UNIPIlocation not on record | 56 |
| Moscow State Universitylocation not on record | 41 |
| MAlocation not on record | 40 |
| Museo Entomologico de Leonlocation not on record | 39 |
| HUN003location not on record | 34 |
| Nanjing, CN | 33 |
| South Kensington, GB | 29 |
| Beijing, CN | 28 |
| Canberra, AU | 26 |
| San Luis Obispo, US | 24 |
| Adam Mickiewicz University in Poznańlocation not on record | 22 |
| ASUlocation not on record | 21 |
| US | 21 |
| Uppsala, SE | 21 |
| València, ES | 19 |
| Canadian Department of Agriculturelocation not on record | 19 |
| Mount Annan, AU | 19 |
| Durango, MX | 18 |
| Philadelphia, US | 17 |
| Auckland, NZ | 17 |
| Guangzhou, CN | 17 |
| CJBGlocation not on record | 16 |
| Barcelona, ES | 16 |
| BClocation not on record | 16 |
| Chengdu, CN | 16 |
| Flagstaff, US | 16 |
| Irvine, US | 15 |
| Bronx, US | 15 |
| Davis, US | 14 |
| Saint Louis, US | 13 |
| Universidad de Antioquia (UdeA)location not on record | 13 |
| Kunming, CN | 12 |
| BDBClocation not on record | 12 |
| Cape Town, ZA | 12 |
| Severin-McDaniel Insect Collectionlocation not on record | 11 |
| Uniwersytet Wrocławskilocation not on record | 11 |
| Berlin, DE | 10 |
| Universidad de Caldas (UCaldas)location not on record | 10 |
| DBF-NHMDlocation not on record | 9 |
| Brussel, BE | 9 |
| Servico de Microbiologia e Imunologialocation not on record | 9 |
| Kew, GB | 9 |
| GMBAlocation not on record | 9 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 9 |
| POL003location not on record | 8 |
| Christchurch, NZ | 8 |
| Phyletisches Museum Jenalocation not on record | 8 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| Oskarshamn, SE | 8 |
| ISAlocation not on record | 8 |
| Yangling, CN | 8 |
| Görlitz, DE | 8 |
| Chongqing Museumlocation not on record | 8 |
| Durban, ZA | 8 |
| Austin, US | 7 |
| Long Beach, US | 7 |
| Bern, CH | 7 |
| Los Angeles, US | 7 |
| Jaén, ES | 7 |
| Kensington, AU | 7 |
| Phoenix, US | 7 |
| Brisbane, AU | 6 |
| Paris, FR | 6 |
| Puerto Ayora, EC | 6 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| UChlocation not on record | 6 |
| Bourges, FR | 6 |
| Olocation not on record | 6 |
| Mexico City, MX | 6 |
| Wellington, NZ | 5 |
| Pullman, US | 5 |
| Universidad del Quindío (UniQuindío)location not on record | 5 |
| GZUlocation not on record | 5 |
| Edinburgh, GB | 5 |
| Porrentruy, CH | 5 |
| Rishon Le Zion, IL | 5 |
| SLU Artdatabankenlocation not on record | 5 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 5 |
| Alicante, ES | 5 |
| Granada, ES | 5 |
| Chengdu, CN | 5 |
| 云南省思茅市民族传统医药研究所location not on record | 5 |
| Guilin, CN | 5 |
| Karlsruhe, DE | 5 |
| Ciudad de México, MX | 4 |
| Québec, CA | 4 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 4 |
| Taipei, TW | 4 |
| Autlán de Navarro, MX | 4 |
| College Park, US | 4 |
| BSBIlocation not on record | 4 |
| Mexico City, MX | 4 |
| Entomological Society of Latvialocation not on record | 4 |
| Allentown, US | 4 |
| Universidad Católica de Oriente (UCO)location not on record | 4 |
| Nijmegen, NL | 4 |
| ROM007location not on record | 4 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 4 |
| EL PASO, US | 4 |
| Uniwersytet Warszawskilocation not on record | 4 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| Dresden, DE | 3 |
| Universidad Nacional de Colombia (UNAL)location not on record | 3 |
| Zürich, CH | 3 |
| JBSlocation not on record | 3 |
| UTPLlocation not on record | 3 |
| CICYTEXlocation not on record | 3 |
| Arcata, US | 3 |
| Zhengzhou, CN | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 3 |
| Wlocation not on record | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Miami, US | 3 |
| Anhui Normal Universitylocation not on record | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| La Paz, MX | 3 |
| Jena Microbial Resource Collectionlocation not on record | 3 |
| Riobamba, EC | 3 |
| AZE015location not on record | 3 |
| Zhejiang Universitylocation not on record | 3 |
| Guatemala, GT | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| New Haven, US | 3 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 2 |
| Hobart, AU | 2 |
| Tilburg, NL | 2 |
| Ensenada, MX | 2 |
| UFOPlocation not on record | 2 |
| Guasave, MX | 2 |
| Salamanca, ES | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Badajoz, ES | 2 |
| New Brunswick, US | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Blumenau, BR | 2 |
| Strecker Museum, Baylor Universitylocation not on record | 2 |
| Logan, US | 2 |
| Chicago, US | 2 |
| University of New Hampshirelocation not on record | 2 |
| San Francisco, US | 2 |
| Tartu, EE | 2 |
| Cape Town, ZA | 2 |
| National Museum Waleslocation not on record | 2 |
| Albuquerque, US | 2 |
| GHPG$location not on record | 2 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 2 |
| Lanzhou, CN | 2 |
| Universidade Federal de Juiz de Foralocation not on record | 2 |
| Sanda, JP | 2 |
| Jyväskylä, FI | 2 |
| Angwin, US | 2 |
| University of Stellenboschlocation not on record | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Awka, NG | 2 |
| Santa Cruz, US | 2 |
| Urumqi, CN | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Frauenfeld, CH | 2 |
| Nanchong, CN | 2 |
| Xian, CN | 2 |
| Armidale, AU | 2 |
| Tlalnepantla, MX | 2 |
| Arizona Western Collegelocation not on record | 2 |
| Pamplona, ES | 2 |
| Taipei, TW | 2 |
| Mlocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Juriquilla, MX | 2 |
| Odawara, JP | 2 |
| Boumlocation not on record | 1 |
| Norfolk, US | 1 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 1 |
| Firenze, IT | 1 |
| Frankfurt am Main | 1 |
| Davenport, US | 1 |
| SNSNMClocation not on record | 1 |
| ROM023location not on record | 1 |
| Stockholm, SE | 1 |
| UFBAlocation not on record | 1 |
| Mississippi State, US | 1 |
| Córdoba, AR | 1 |
| Museo Achille Folettolocation not on record | 1 |
| MKD001location not on record | 1 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 1 |
| Vitoria, ES | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| BFLlocation not on record | 1 |
| Sevilla, ES | 1 |
| GB | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| Moscow, US | 1 |
| Hermosillo, MX | 1 |
| Corvallis, US | 1 |
| Yaoundé, CM | 1 |
| Salvador, BR | 1 |
| Linares, MX | 1 |
| Namur, BE | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| San Jose, US | 1 |
| Porvoo, FI | 1 |
| Valparaiso, CL | 1 |
| Puebla, MX | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Madrid, ES | 1 |
| Fullerton, US | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Bratislava, SK | 1 |
| Burlington, US | 1 |
| Wuhan, CN | 1 |
| Columbia, US | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Université de Bordeauxlocation not on record | 1 |
| UBT-Kaullocation not on record | 1 |
| Oulu, FI | 1 |
| Provincia di Livornolocation not on record | 1 |
| Pomona Collegelocation not on record | 1 |
| Stockholm, SE | 1 |
| CASlocation not on record | 1 |
| FJFClocation not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Central China Normal Universitylocation not on record | 1 |
| Sri Ramaswamy Memorial Universitylocation not on record | 1 |
| Yunnan Universitylocation not on record | 1 |
| WNNUlocation not on record | 1 |
| Shanghai, CN | 1 |
| Zürich, CH | 1 |
| Northeastern Forestry Universitylocation not on record | 1 |
| Antiguo Cuscatlán, SV | 1 |
| Philadelphia, US | 1 |
| Bangkok, TH | 1 |
| Northridge, US | 1 |
| Palacký University in Olomouclocation not on record | 1 |
| CBDClocation not on record | 1 |
| Hangzhou, CN | 1 |
| Guangzhou, CN | 1 |
| Shanghai, CN | 1 |
| PUC-RSlocation not on record | 1 |
| Zhuzhou, CN | 1 |
| Fort Worth, US | 1 |
| Toluca, MX | 1 |
| Chapingo, MX | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Catholic University of Pekinglocation not on record | 1 |
| KMNlocation not on record | 1 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| Palmerston, AU | 1 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 1 |
| Trondheim, NO | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
265 institutions · 2 241 of 2 643 vouchered records shown · 362 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA55 detections
Where the DNA of Apium graveolens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found55
Studies independent surveys4
Countries9
Verifiable raw sequence linked8
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 55 detections have coordinates
Open the map9 countries0
Chaparral and Desert Scrub communities
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
Temperature22.6 °C 14.8–31.1
Conductivity50,802 µS/cm 43,306–57,765
Salinity35.5 PSU 28.8–35.9
Dissolved oxygen7.09 mg/L 6.35–7.84
Turbidity0.342 NTU 0.073–3.05
Nitrate0.8 µmol/L 0.1–3.80
Depth2.00 m 0–50.0
Coastal waterPelagic
24 samples with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.0 °C 8.50–25.6
Seasonal swing summer↔winter8.70 °C
Max temp (day)20.1 °C 12.9–28.4
Min temp (night)13.9 °C 4.60–22.3
Precipitation73.8 mm/mo 23.7–138
Air humidity59.4 % 56.3–64.0
Moisture balance50.1 mm/mo
Vapour deficit804 Pa 517–1,287
Wind speed6.00 m/s
Cloud cover38.4 % 18.2–59.5
CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.