Apium annuum

P.S.Short · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Apium

At a glance

Occurrence records1 084

Data sources8

Biological traits30

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Apium annuum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 084 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF1 084 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Apium annuum is one of the 20 species of the genus Apium of the family Apiaceae. It is an annual herb with a distribution in salt-marsh and saline habitats of Victoria, south and western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Fruit length1.5 mm

Fruit width2.05 mm

Leaf length32.5 mm

Leaf width30 mm

Plant height0.2 m

Plant height max0.2 m

Plant height min0.03 m

Seed mass0.28 mg

⚠ sources differ — TRY: 0.28 mg · AusTraits: 0.565 mg · GIFT: 0.275 mg

Seed mass max0.29 mg

Seed mass min0.26 mg

Life cycle & reproduction8

Dispersal typeanimal

Flowering timennnnnnnyyyyn

Life formannual

Life spanannual

Pollination syndromeinsect

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit typemericarp

Growth formherb

Leaf compoundnesscompound

Leaf shapeobtriangular ovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apium annuum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKJ473892.1 ↗597 bp

ACGT

TCGAATCCTGCGATAGCAGAATGACCCGCTAACACGTAAACACATTGGGCAAGCGTCGGTGGGCTTTGGTCCGCCGTTTGCAAACCTTTG …

Apium annuum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type1 084 records

Wild obs. + sensor538

Museum / vouchered546

Origin

Native287

Range

Area of Occupancy AOO2 820 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 363≤1 km 106≤10 km 59>10 km 6

534 georeferenced · 4 without coordinates

Open the mapobservation + sensor538

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 115≤1 km 152≤10 km 211>10 km 31

509 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence546

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	254
Kensington, AU	97
Museo Entomologico de Leonlocation not on record	65
Canberra, AU	51
Mount Annan, AU	15
Hobart, AU	10
Auckland, NZ	3
Brisbane, AU	2
EL PASO, US	2
Kew, GB	2
MeiseBGlocation not on record	1

11 institutions · 502 of 546 vouchered records shown · 44 without an institution code

09Environmental DNA1 detections

Where the DNA of Apium annuum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apium annuum

At a glance

Sources8 archives

Size & morphology10

Life cycle & reproduction8

Diet & foraging1

Habitat & environment8

Physiology & chemistry2

Other traits1

At a glance

Record type1 084 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 084 records