Apistosia judas

Hübner, 1827 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Apistosia

At a glance

Occurrence records841

Data sources6

Biological traits0

DNA specimens54

eDNA detections55

Sources6 archives

Databases and archives Apistosia judas's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility841 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI55 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics54 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF841 records

Environmental DNA1 datasets · 8 countries55 detections

DNA & barcodingBOLD54 specimens

01Narrative

Apistosia judas is a moth of the subfamily Arctiinae. It was described by Jacob Hübner in 1827. It is found in Guatemala, Honduras, Brazil, Nicaragua and Panama.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding54 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apistosia judas has left across the world's sequence archives.

At a glance

DNA specimens54

BINs1

Marker genes1

eDNA detections55

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus54 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

103Cmostly conserved

214Amostly conserved

271Cmostly conserved

367Tmostly conserved

619Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.31%

Haplotypes8

BIN1

Most divergent pair0.76%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gnamptonychia ventralissame family4.6%Agylla separatasame family5.6%Agylla subochraceasame family5.6%Inopsis modulatasame family5.8%Agylla septentrionalissame family5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type841 records

Wild obs. + sensor687

Museum / vouchered154

Range

Area of Occupancy AOO1 764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 278≤1 km 174≤10 km 67>10 km 20

539 georeferenced · 148 without coordinates

Open the mapobservation + sensor687

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 25

25 georeferenced · 129 without coordinates

Open the institutions mapphysical evidence154

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	106
Tapachula, MX	12
Mississippi State, US	5
Ciudad de México, MX	4
Mexico City, MX	3

5 institutions · 130 of 154 vouchered records shown · 24 without an institution code

09Environmental DNA55 detections

Where the DNA of Apistosia judas was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found55

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 55 detections have coordinates

Open the map8 countries0

1. Forest & Woodland | 1.6. Subtropical/Trop…1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland|1.6. Subtropical/Tropic…Lowland rainforest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 21.9–27.0

Seasonal swing summer↔winter2.40 °C

Max temp (day)27.6 °C 24.8–31.0

Min temp (night)21.6 °C 19.5–23.2

Precipitation334 mm/mo 173–418

Air humidity69.6 % 65.3–78.7

Moisture balance162 mm/mo 11.6–288

Vapour deficit901 Pa 549–1,198

Wind speed2.20 m/s 0.9–4.20

Cloud cover45.6 % 25.8–58.0

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)