Apistogramma eremnopyge

Ready & Kullander, 2004 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Cichlidae/Apistogramma

At a glance

Occurrence records19

Data sources8

Biological traits4

DNA specimens8

eDNA detections8

Sources8 archives

Databases and archives Apistogramma eremnopyge's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility19 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF19 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Apistogramma eremnopyge is a species of cichlid. It is only known from the Rio Pintuyacu, a tributary of the Rio Itaya near Iquitos, Peru. Most of the tributaries of this river system carry acid blackwater (pH ~ 5). This is a small cichlid, 26 – standard length which can be easily distinguished from its congeners by the presence of a prominent dark blotch on the lower part of the caudal peduncle in both sexes. The male is strikingly coloured with vivid blue and red patterning on the cheek and operculum and maroon, orange and blue colouring on the dorsal fin.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length3.44 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apistogramma eremnopyge has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P579 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.04%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

436Amostly conserved

TTTGGTGCTTTTGCCGGATTAGTGGGCGCCGCGTTAAGCACACTGATTCGAGCAGAACTTACTCAGTCCGGCTCCCTTTTTGAAGACGAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apistogramma bitaeniatasame genus4.8%Apistogramma pertensissame genus12.9%Apistogramma agassiziisame genus13.1%Apistogramma wollisame genus17.2%Apistogramma barlowisame genus17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type19 records

Museum / vouchered19

Range

Area of Occupancy AOO12 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 15

15 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence19

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	15
Stockholm, SE	1

2 institutions · 16 of 19 vouchered records shown · 3 without an institution code

09Environmental DNA8 detections

Where the DNA of Apistogramma eremnopyge was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.6–25.7

Seasonal swing summer↔winter1.30 °C

Max temp (day)29.1 °C 29.1–29.7

Min temp (night)22.4 °C 22.4–22.8

Precipitation144 mm/mo 144–296

Air humidity68.5 % 68.5–71.5

Moisture balance17.9 mm/mo 17.9–163

Vapour deficit1,043 Pa 929–1,043

Wind speed0.8 m/s 0.7–0.8

Cloud cover57.9 % 57.0–57.9

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)