Apisa canescens

Walker, 1855 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Apisa

At a glance

Occurrence records121

Data sources7

Biological traits0

DNA specimens20

eDNA detections65

Sources7 archives

Databases and archives Apisa canescens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility121 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI65 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF121 records

Environmental DNA1 datasets · 4 countries65 detections

DNA & barcodingBOLD20 specimens

01Narrative

Apisa canescens is a moth of the family Erebidae. It was described by Francis Walker in 1855. It is found in the Republic of the Congo, the Democratic Republic of the Congo, Eritrea, Ethiopia, Gabon, Kenya, Namibia, Rwanda, Saudi Arabia, Sierra Leone, Somalia, South Africa and Tanzania.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apisa canescens has left across the world's sequence archives.

At a glance

DNA specimens20

BINs8

Marker genes2

eDNA detections65

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 67 variable positions, in barcode order

10Tmostly conserved

13Tmostly conserved

34Amostly conserved

38Gmostly conserved

40Amostly conserved

59Tvariable

64Tmostly conserved

85Cvariable

118Tmostly conserved

133Avariable

166Amostly conserved

172Tmostly conserved

211Amostly conserved

212Tvariable

214Amostly conserved

217Tmostly conserved

220Cmostly conserved

235Cvariable

238Tvariable

241Amostly conserved

266Tvariable

283Tmostly conserved

284Cvariable

286Tvariable

289Tmostly conserved

298Tmostly conserved

304Tmostly conserved

349Tmostly conserved

355Tvariable

364Tvariable

367Tmostly conserved

376Amostly conserved

385Cmostly conserved

400Cvariable

401Tmostly conserved

403Amostly conserved

412Avariable

421Tvariable

439Tmostly conserved

448Tmostly conserved

457Tmostly conserved

460Tmostly conserved

470Tvariable

479Tmostly conserved

484Tvariable

490Tmostly conserved

499Tvariable

505Tmostly conserved

508Avariable

512Tvariable

513Cmostly conserved

514Avariable

517Amostly conserved

536Tmostly conserved

548Tmostly conserved

556Tmostly conserved

562Amostly conserved

581Cmostly conserved

583Tmostly conserved

610Tmostly conserved

613Tmostly conserved

616Tvariable

622Amostly conserved

628Amostly conserved

631Amostly conserved

640Tmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.9%

Haplotypes15

BINs8

Most divergent pair7.4%

AfricaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Balacra rubricinctasame family4.4%Balacra haemaleasame family4.7%Balacra flavimaculasame family4.9%Balacra pulchrasame family4.9%Balacra eleganssame family5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type121 records

Wild obs. + sensor91

Museum / vouchered30

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 44≤1 km 12≤10 km 4>10 km 1

61 georeferenced · 30 without coordinates

Open the mapobservation + sensor91

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 30 records without

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Durban Natural Science Museumlocation not on record	26

1 institutions · 26 of 30 vouchered records shown · 4 without an institution code

09Environmental DNA65 detections

Where the DNA of Apisa canescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found65

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 65 detections have coordinates

Open the map4 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 24.2–26.7

Seasonal swing summer↔winter2.30 °C

Max temp (day)30.8 °C 28.2–30.9

Min temp (night)22.7 °C 21.3–23.2

Precipitation148 mm/mo 91.6–282

Air humidity66.5 % 65.0–70.4

Moisture balance12.8 mm/mo -43.0–152

Vapour deficit1,183 Pa 893–1,199

Wind speed1.10 m/s 0.8–1.70

Cloud cover44.1 % 26.0–56.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)