Apis nigrocincta

Smith, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Apis

At a glance

Occurrence records39

Data sources7

Biological traits0

DNA specimens56

eDNA detections37

Sources7 archives

Databases and archives Apis nigrocincta's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility39 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics56 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF39 records

Environmental DNA1 datasets · 2 countries37 detections

DNA & barcodingBOLD56 specimens

01Narrative

Apis nigrocincta is a species of honey bee that inhabits the Philippine island of Mindanao as well as the Indonesian islands of Sangihe and Sulawesi. The species is known to have queens with the highest mating frequencies of any species of the tribe Apini. It is a middle-sized species of the tribe Apini, compared to the larger A. dorsata or smaller A. florea.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding56 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apis nigrocincta has left across the world's sequence archives.

At a glance

DNA specimens56

BINs4

Marker genes2

eDNA detections37

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 104 variable positions, in barcode order

1Amostly conserved

4Tmostly conserved

11Amostly conserved

14Tmostly conserved

16Avariable

23Tmostly conserved

37Amostly conserved

43Cmostly conserved

55Gvariable

58Gvariable

59Amostly conserved

61Tmostly conserved

62Gvariable

67Cvariable

68Amostly conserved

76Amostly conserved

82Cvariable

85Cvariable

88Tmostly conserved

91Avariable

94Amostly conserved

122Gvariable

127Amostly conserved

133Amostly conserved

142Cvariable

143Cmostly conserved

145Amostly conserved

163Tmostly conserved

172Cvariable

173Cvariable

184Tmostly conserved

205Tvariable

220Tmostly conserved

223Avariable

229Amostly conserved

259Cmostly conserved

265Gvariable

266Cmostly conserved

268Tvariable

271Tmostly conserved

274Tvariable

277Amostly conserved

280Amostly conserved

283Tmostly conserved

284Avariable

286Amostly conserved

293Tmostly conserved

316Amostly conserved

322Amostly conserved

325Amostly conserved

334Amostly conserved

337Tvariable

340Tmostly conserved

343Tmostly conserved

346Avariable

347Tmostly conserved

358Tmostly conserved

359Tmostly conserved

370Amostly conserved

373Cvariable

376Tmostly conserved

379Amostly conserved

382Tvariable

392Amostly conserved

394Tmostly conserved

397Cvariable

400Cvariable

401Tvariable

403Avariable

418Cmostly conserved

424Amostly conserved

433Amostly conserved

448Amostly conserved

451Tmostly conserved

454Amostly conserved

490Cvariable

499Tmostly conserved

505Tmostly conserved

523Tmostly conserved

529Avariable

532Cmostly conserved

533Tmostly conserved

541Tmostly conserved

547Tmostly conserved

548Cmostly conserved

550Tmostly conserved

556Tmostly conserved

557Cmostly conserved

559Amostly conserved

568Amostly conserved

574Amostly conserved

581Tmostly conserved

583Amostly conserved

592Amostly conserved

604Tmostly conserved

616Tmostly conserved

619Avariable

625Amostly conserved

631Amostly conserved

634Tmostly conserved

637Amostly conserved

646Tmostly conserved

652Tmostly conserved

655Amostly conserved

AATTTTATATATTTTATTAGCTTTATGATCAGGAATATTAGGCTCATCAATAAGGTTGATTGTTCGCATAGAATTAAGATCCCCCGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.9%

Haplotypes13

BINs3

Most divergent pair11.7%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apis koschevnikovisame genus8.8%Apis laboriosasame genus9.1%Apis dorsatasame genus9.2%Apis melliferasame genus10.4%Apis floreasame genus10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_038114 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type39 records

Wild obs. + sensor16

Museum / vouchered23

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 3≤1 km 5≤10 km 1>10 km 1

10 georeferenced · 6 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	9
OSUClocation not on record	8

2 institutions · 17 of 23 vouchered records shown · 4 without an institution code

09Environmental DNA37 detections

Where the DNA of Apis nigrocincta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 19.0–26.1

Seasonal swing summer↔winter13.2 °C

Max temp (day)27.4 °C 23.4–29.3

Min temp (night)20.7 °C 14.8–23.7

Precipitation183 mm/mo 72.7–326

Air humidity65.5 % 59.8–69.2

Moisture balance40.5 mm/mo -33.1–175

Vapour deficit1,025 Pa 876–1,072

Wind speed2.20 m/s 0.8–3.20

Cloud cover34.2 % 28.2–51.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)