Apion cruentatum

Walton, 1844 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Apionidae/Apion

At a glance

Occurrence records1 541

Data sources6

Biological traits2

DNA specimens12

eDNA detections13

Sources6 archives

Databases and archives Apion cruentatum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 541 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 541 records

Environmental DNA1 datasets · 6 countries13 detections

DNA & barcodingBOLD12 specimens

01Narrative

Apion cruentatum is a species of beetle in the family Brentidae. It is found in the Palearctic.Joy, N. (1932). A Practical Handbook of British Beetles.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apion cruentatum has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections13

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

32Gmostly conserved

74Cmostly conserved

76Amostly conserved

82Tmostly conserved

85Tmostly conserved

112Tmostly conserved

214Avariable

241Avariable

325Avariable

334Tmostly conserved

349Amostly conserved

565Amostly conserved

AACACTATATTTTATTTTTGGGTTATGGTCAGGAATAATTGGAACATCACTTAGAATATTAATTCGTGTAGAACTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.56%

Haplotypes6

BIN1

Most divergent pair1.1%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apion haematodessame genus6.5%Apion frumentariumsame genus7.1%Apion rubenssame genus11.8%Bledius furcatussame order13.8%Cheritra frejasame order14.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 541 records

Wild obs. + sensor716

Museum / vouchered803

Cultivated / captive5

Fossil9

Other8

Range

Area of Occupancy AOO3 976 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 326≤1 km 232≤10 km 92

650 georeferenced · 66 without coordinates

Open the mapobservation + sensor716

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 122≤1 km 296≤10 km 270>10 km 20

708 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence803

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	233
Olocation not on record	117
NHMOlocation not on record	92
CBDClocation not on record	38
Trondheim, NO	30
MNHWlocation not on record	26
Uniwersytet Jagiellońskilocation not on record	26
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	21
Kuopio, FI	20
UJAG-IZlocation not on record	17
Helsinki, FI	17
BioFokuslocation not on record	10
Muzeum Górnośląskie w Bytomiulocation not on record	9
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	9
NTNU-VMlocation not on record	8
neflocation not on record	7
Uniwersytet Wrocławskilocation not on record	7
TMPMlocation not on record	7
Tilburg, NL	6
Oulu, FI	6
Tartu, EE	6
Natural History Museum Rotterdamlocation not on record	5
Salzburg, AT	5
Metsähallituslocation not on record	5
Provincia di Livornolocation not on record	5
MZLUlocation not on record	3
NCMGlocation not on record	3
IFR-DNFlocation not on record	1
Philadelphia, US	1

29 institutions · 740 of 803 vouchered records shown · 63 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA13 detections

Where the DNA of Apion cruentatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map6 countries0

ojanpenkka

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.8 °C 1.80–14.3

Seasonal swing summer↔winter19.5 °C

Max temp (day)14.0 °C 4.30–17.8

Min temp (night)8.00 °C -0.9–11.0

Precipitation92.8 mm/mo 51.8–175

Air humidity63.7 % 60.0–67.4

Moisture balance32.4 mm/mo -56.2–57.4

Vapour deficit489 Pa 237–633

Wind speed3.10 m/s 2.70–5.40

Cloud cover41.8 % 36.5–53.5

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apion cruentatum

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type1 541 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 29 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 541 records