Apiognomonia errabunda

(Roberge ex Desm.) Höhn. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Diaporthales/Gnomoniaceae/Apiognomonia

At a glance

Occurrence records448

Data sources9

Biological traits0

DNA specimens43

eDNA detections84

Sources9 archives

Databases and archives Apiognomonia errabunda's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility448 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI84 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF448 records

Environmental DNA5 datasets · 11 countries84 detections

DNA & barcodingBOLD · NCBI43 specimens

01Narrative

Apiognomonia errabunda is a fungal plant pathogen and causal agent of oak anthracnose. It is one of the most widespread leaf-associated fungi in the northern temperate zone and is found mostly on oak, beech, and linden trees.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apiognomonia errabunda has left across the world's sequence archives.

At a glance

DNA specimens43

Marker genes3

GenBank sequences10

eDNA detections84

Countries11

The DNA barcodea real sequence read deposited for this species

ITSPX740819.1 ↗553 bpSweden · 2020

ACGT

GAGGGATCATTGCTGGAATAAACGCCCTCACGGGTGCTACCCAGAAACCCTTTGTGAATACTACCTAAAATGTTGCCTCGGCATTGGTTG …

Apiognomonia errabunda isolate FS213 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS2

fungal barcode

08Occurrence & distribution

Record type448 records

Wild obs. + sensor246

Museum / vouchered200

Other2

Range

Area of Occupancy AOO1 316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 56≤1 km 29≤10 km 113>10 km 1

199 georeferenced · 47 without coordinates

Open the mapobservation + sensor246

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 14≤1 km 37≤10 km 48>10 km 7

106 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence200

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	33
Helsinki, FI	26
Uniwersytet Łódzkilocation not on record	11
Uppsala, SE	9
Turku, FI	7
DPIlocation not on record	7
Bernard Price Institute for Palaeontological Researchlocation not on record	5
ILLSlocation not on record	5
Slovenian Forestry Institutelocation not on record	4
LDlocation not on record	4
Museo Entomologico de Leonlocation not on record	3
Karlsruhe, DE	3
Görlitz, DE	2
Berlin, DE	2
FLASlocation not on record	2
Champaign, US	2
Catholic University of Pekinglocation not on record	2
WU-MYClocation not on record	2
Uniwersytet Jagiellońskilocation not on record	1
Olocation not on record	1
Pullman, US	1
Kew, GB	1
Trondheim, NO	1
Vancouver, CA	1
Copenhagen, DK	1

25 institutions · 136 of 200 vouchered records shown · 39 without an institution code

09Environmental DNA84 detections

Where the DNA of Apiognomonia errabunda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found84

Studies independent surveys5

Countries11

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 84 detections have coordinates

Open the map11 countries0

Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.20 °C -2.50–16.3

Seasonal swing summer↔winter21.5 °C

Max temp (day)11.2 °C 0.9–19.7

Min temp (night)4.60 °C -7.30–12.8

Precipitation69.2 mm/mo 50.3–175

Air humidity62.4 % 60.2–64.7

Moisture balance5.70 mm/mo -33.7–118

Vapour deficit399 Pa 219–697

Wind speed4.20 m/s 2.50–6.90

Cloud cover46.4 % 37.8–57.0

CHELSA 1981–2010, ~9 km grid, at location & month of 67 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)