Apiloscatopse scutellata

(Loew, 1846) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Scatopsidae/Apiloscatopse

At a glance

Occurrence records53

Data sources7

Biological traits0

DNA specimens19

eDNA detections1

Sources7 archives

Databases and archives Apiloscatopse scutellata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility53 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF53 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD19 specimens

01Narrative

Apiloscatopse scutellata is a species of fly in the family Scatopsidae. It is found in the Palearctic .Fauna EuropaeaBei-Bienko, G.Y. & Steyskal, G.C. (1988) Keys to the Insects of the European Part of the USSR, Volume V: Diptera and Siphonaptera, Parts I, II. Amerind Publishing Co., New Delhi.Séguy, E. (1940) Diptères (Nématocères). 367 p., 414 fig. Éditions Faune de France n° 36 (FdeFr36)Dipt.nematoceres.pdf Bibliotheque Virtuelle Numerique pdf

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apiloscatopse scutellata has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

33Amostly conserved

99Tmostly conserved

183Gvariable

342Tvariable

495Gmostly conserved

498Tmostly conserved

627Amostly conserved

ACTCTATATTTTATTTTTGGAGCCTGAGCAGGAATAGTAGGTACTTCCCTTAGTATCTTAGTCCGTGCAGAATTAGGACACCCCGGAGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.25%

Haplotypes6

BIN1

Most divergent pair0.61%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apiloscatopse piceasame genus8.4%Apiloscatopse flavocinctasame genus10.2%Chionea lutescenssame order11.7%Minilimosina gemellasame order12.0%Rhamphomyia barbatasame order12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type53 records

Wild obs. + sensor39

Museum / vouchered14

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 14≤1 km 10≤10 km 13

37 georeferenced · 2 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤1 km 3≤10 km 2

5 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
ZSMlocation not on record	4
Bavarian State Collection of Zoologylocation not on record	4
SGAV-and-NHMDlocation not on record	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
NCMGlocation not on record	2

5 institutions · 14 of 14 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Apiloscatopse scutellata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.20 °C 9.20–9.20

Seasonal swing summer↔winter18.5 °C

Max temp (day)13.7 °C

Min temp (night)5.50 °C

Precipitation71.6 mm/mo

Air humidity64.7 %

Moisture balance29.7 mm/mo

Vapour deficit411 Pa

Wind speed2.20 m/s

Cloud cover44.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)