Apilocrocis glaucosia

Hampson, 1912 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Crambidae/Apilocrocis

At a glance

Occurrence records136

Data sources6

Biological traits0

DNA specimens17

eDNA detections16

Sources6 archives

Databases and archives Apilocrocis glaucosia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility136 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF136 records

Environmental DNA1 datasets · 2 countries16 detections

DNA & barcodingBOLD17 specimens

01Narrative

Apilocrocis glaucosia is a moth in the family Crambidae. It was described by George Hampson in 1912. It is found in Panama, Guatemala and Mexico. The wingspan is 28–32 mm. The forewings are pale glaucous grey. The costa is white with a fulvous streak below it and there is a fuscous subbasal shade from the cell to the inner margin, followed by a whitish band. There is also a quadrate semihyaline white spot just beyond the discocellulars. The hindwings are pale glaucous grey with a semihyaline white basal area.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apilocrocis glaucosia has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes1

eDNA detections16

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.14%

Haplotypes2

BIN1

Most divergent pair0.91%

Where individuals differ — all 7 variable positions, in barcode order

101Gmostly conserved

265Amostly conserved

274Amostly conserved

367Tmostly conserved

421Tmostly conserved

526Amostly conserved

571Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGAACATCTCTTAGTTTATTAATTCGAGCCGAATTAGGAAATCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apilocrocis brumalissame genus1.5%Apilocrocis pimalissame genus3.6%Apilocrocis excelsalissame genus4.3%Apilocrocis novateutonialissame genus4.7%Diaphantania impulsalissame family5.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type136 records

Wild obs. + sensor1

Museum / vouchered135

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 135 records without

Open the institutions mapphysical evidence135

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	115
Tapachula, MX	8
Area de Conservacion Guanacastelocation not on record	1

3 institutions · 124 of 135 vouchered records shown · 11 without an institution code

09Environmental DNA16 detections

Where the DNA of Apilocrocis glaucosia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 24.4–25.2

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.4 °C 26.9–27.6

Min temp (night)22.8 °C 21.6–23.0

Precipitation349 mm/mo 302–401

Air humidity73.4 % 69.1–74.1

Moisture balance196 mm/mo 151–255

Vapour deficit843 Pa 808–939

Wind speed3.10 m/s 2.50–3.60

Cloud cover38.5 % 33.8–41.1

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)