Aphytis lepidosaphes

Compere, 1955 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Aphelinidae/Aphytis

At a glance

Occurrence records42

Data sources6

Biological traits0

DNA specimens28

eDNA detections49

Sources6 archives

Databases and archives Aphytis lepidosaphes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility42 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI49 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF42 records

Environmental DNA1 datasets · 4 countries49 detections

DNA & barcodingBOLD28 specimens

01Narrative

Aphytis lepidosaphes is een vliesvleugelig insect uit de familie Aphelinidae. De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1955 door Compere.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphytis lepidosaphes has left across the world's sequence archives.

At a glance

DNA specimens28

BINs1

Marker genes1

eDNA detections49

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AATTTTATATTTTATTTTTGGAACTTGAGCAGGAATTTTAGGGTTATCAATAAGATTAATTATTCGATTAGAATTAGGAAATCCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphytis hispanicussame genus7.2%Aphytis melinussame genus7.5%Aphytis chrysomphalisame genus8.0%Trichogramma euproctidissame order9.6%Trichogramma chilonissame order10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type42 records

Wild obs. + sensor6

Museum / vouchered36

Range

Area of Occupancy AOO60 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 6

6 georeferenced

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Agricultural Research Council-Plant Protection Research Institutelocation not on record	2
Riverside, US	1
Washington, US	1

3 institutions · 4 of 36 vouchered records shown · 32 without an institution code

09Environmental DNA49 detections

Where the DNA of Aphytis lepidosaphes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found49

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 49 detections have coordinates

Open the map4 countries0

3. Shrubland | 3.5. Subtropical/Tropical Dry…Suburban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 12.2–22.8

Seasonal swing summer↔winter8.40 °C

Max temp (day)23.4 °C 19.6–28.2

Min temp (night)16.6 °C 8.50–22.4

Precipitation28.3 mm/mo 1.10–96.4

Air humidity61.5 % 51.9–67.3

Moisture balance-54.8 mm/mo

Vapour deficit909 Pa 655–1,216

Wind speed2.40 m/s

Cloud cover25.7 % 7.50–60.8

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)