Aphyocypris kikuchii

(Oshima, 1919) · species

image placeholder — illustration coming later

Animalia/Chordata/Cypriniformes/Cyprinidae/Aphyocypris

At a glance

Occurrence records272

Data sources7

Biological traits6

DNA specimens18

eDNA detections9

Sources7 archives

Databases and archives Aphyocypris kikuchii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility272 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF272 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD18 specimens

01Narrative

Aphyocypris kikuchii is a species of cyprinid fish. It is endemic to Taiwan. It is a benthopelagic freshwater fish that grows to 8 cm total length. Named in honor of Yonetaro Kikuchi (1869-1921), collector for the Taipei Museum in Formosa (Taiwan), who collected the type specimen.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length8 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits3

Depth max5 m

Depth min0 m

Vulnerability10

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphyocypris kikuchii has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes11

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.32%

Haplotypes2

BIN1

Most divergent pair0.31%

Where individuals differ — all 6 variable positions, in barcode order

191Tmostly conserved

257Tmostly conserved

325Avariable

326Tmostly conserved

506Tmostly conserved

580Tvariable

CCTTTATCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGAACCGCCCTAAGCCTTCTCATTCGAGCCGAACTAAGCCAACCTGGGTCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphyocypris chinensissame genus3.5%Aphyocypris normalissame genus11.5%Aphyocypris moltrechtisame genus11.8%Squaliobarbus curriculussame family11.9%Xenocypris davidisame family12.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_019620 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type272 records

Wild obs. + sensor230

Museum / vouchered12

Other30

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 212>10 km 15

227 georeferenced · 3 without coordinates

Open the mapobservation + sensor230

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	5
Ann Arbor, US	5
FishBaselocation not on record	2

3 institutions · 12 of 12 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Aphyocypris kikuchii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.5 °C 10.0–23.7

Seasonal swing summer↔winter9.90 °C

Max temp (day)20.8 °C 15.7–24.6

Min temp (night)13.6 °C 3.10–22.3

Precipitation63.7 mm/mo 13.8–168

Air humidity64.3 % 45.7–64.9

Moisture balance2.00 mm/mo

Vapour deficit827 Pa 780–1,047

Wind speed4.50 m/s

Cloud cover40.9 % 24.1–49.5

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)