Aphyllon cooperi

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Orobanchaceae/Aphyllon

At a glance

Occurrence records1 748

Data sources6

Biological traits0

DNA specimens2

eDNA detections3

Sources6 archives

Databases and archives Aphyllon cooperi's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 748 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF1 748 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphyllon cooperi has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKX161186.1 ↗555 bpMexico

ACGT

CGAGCCTGCCTAAGTAGACTGTGAACACGTAATCATATTGGGATTGTGTTGTGGTGGAAATCCATATCATAGTCTCCTCCTACATATGCG …

Orobanche cooperi isolate Colwell02-06_WTU351385 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS7

plant barcodefungal barcode

08Occurrence & distribution

Record type1 748 records

Wild obs. + sensor1 655

Museum / vouchered93

Range

Area of Occupancy AOO3 424 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 861≤1 km 119≤10 km 52>10 km 73

1 105 georeferenced · 550 without coordinates

Open the mapobservation + sensor1 655

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 2≤1 km 12≤10 km 34>10 km 3

51 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence93

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	24
Santa Barbara, US	13
Davis, US	9
San Luis Obispo, US	8
Saint Louis, US	5
Arcata, US	4
Severin-McDaniel Insect Collectionlocation not on record	4
Claremont, US	3
Albuquerque, US	1
CASlocation not on record	1
Riverside, US	1
Philadelphia, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
ASUlocation not on record	1

14 institutions · 76 of 93 vouchered records shown · 17 without an institution code

09Environmental DNA3 detections

Where the DNA of Aphyllon cooperi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphyllon cooperi

At a glance

Sources6 archives

At a glance

Record type1 748 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 748 records