Aphthona strigosa

Baly, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Chrysomelidae/Aphthona

At a glance

Occurrence records369

Data sources5

Biological traits0

DNA specimens5

eDNA detections6

Sources5 archives

Databases and archives Aphthona strigosa's data was compiled from.

GBIFGlobal Biodiversity Information Facility369 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF369 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD5 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphthona strigosa has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes3

eDNA detections6

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P633 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

18Avariable

57Avariable

285Avariable

300Gvariable

303Tvariable

384Gvariable

447Cvariable

609Avariable

612Avariable

621Cvariable

633Avariable

TTTGGTATTTGATCAGGAATAGTTGGAACTTCTTTAAGAATATTAATTCGAACAGAATTAGGAAATCCTGGATCATTAATTGGAAATGAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes3

BIN1

Most divergent pair1.4%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mantura chrysanthemisame family11.7%Orestia punctipennissame family11.7%Longitarsus ferrugineussame family12.3%Glyptina atriventrissame family13.0%Tinea flavescentellasame order13.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type369 records

Wild obs. + sensor286

Museum / vouchered83

Range

Area of Occupancy AOO876 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 39≤1 km 23≤10 km 14>10 km 28

104 georeferenced · 182 without coordinates

Open the mapobservation + sensor286

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 81 without coordinates

Open the institutions mapphysical evidence83

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chiba, JP	31
NSMKlocation not on record	21
Sagamihara, JP	18
Yamaguchi-shi, JP	8
Cambridge, US	2
Toyota city nature sanctuarylocation not on record	2

6 institutions · 82 of 83 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Aphthona strigosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

1. Forest & Woodland | 1.9. Subtropical/Trop…1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.0 °C 12.0–25.6

Seasonal swing summer↔winter12.5 °C

Max temp (day)23.0 °C 17.2–28.5

Min temp (night)15.4 °C 5.60–21.8

Precipitation139 mm/mo 38.8–280

Air humidity65.4 % 49.6–67.4

Moisture balance10.0 mm/mo -74.2–152

Vapour deficit827 Pa 810–1,084

Wind speed1.90 m/s 1.80–4.00

Cloud cover39.9 % 27.3–54.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)