Aphroditeola olida

(Quél.) Redhead & Manfr.Binder · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hygrophoraceae/Aphroditeola

At a glance

Occurrence records753

Data sources7

Biological traits0

DNA specimens5

eDNA detections6

Sources7 archives

Databases and archives Aphroditeola olida's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility753 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF753 records

Environmental DNA2 datasets · 3 countries6 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

De geurende schijncantharel is een schimmel behorend tot de familie Hygrophoraceae. Hij leeft saprotroof op de grond vooral in naaldbos. Hij komt voor op strooisel. Vruchtlichamen komen voor van augustus tot in oktober.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphroditeola olida has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

GenBank sequences10

eDNA detections6

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMG919993.1 ↗205 bpUSA · 2011

ACGT

CATTATCGAAGATGGGGAGTGGTTGTTGCTGGCTCTCCGGAGCATGTGCACGCCCTGCCTAACAACTTCTACCCACCTGTGCACTCTTGT …

Aphroditeola olida voucher MushroomObserver.org/68404 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, region

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type753 records

Wild obs. + sensor644

Museum / vouchered105

Other4

Range

Area of Occupancy AOO1 692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 459≤1 km 89≤10 km 32>10 km 21

601 georeferenced · 43 without coordinates

Open the mapobservation + sensor644

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 39≤1 km 27≤10 km 7>10 km 1

74 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence105

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	35
SLU Artdatabankenlocation not on record	12
Oulu, FI	10
Helsinki, FI	7
BDBClocation not on record	6
Vancouver, CA	5
Acadia Universitylocation not on record	4
Kuopio, FI	3
WU-MYClocation not on record	3
Denver, US	2
Chicago, US	2
WTUlocation not on record	2
University of Oslo, Natural History Museumlocation not on record	2
Salzburg, AT	1
Finnish Museum of Natural History, Botanical Museumlocation not on record	1
San Sebastián, ES	1
Gijón, ES	1
TENN-Flocation not on record	1
Santa Cruz, US	1
Trondheim, NO	1

20 institutions · 100 of 105 vouchered records shown · 5 without an institution code

09Environmental DNA6 detections

Where the DNA of Aphroditeola olida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys2

Countries3

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

Funnet i mosebunn. Skogen rundt var mest fur…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 8.80–16.6

Seasonal swing summer↔winter22.9 °C

Max temp (day)16.3 °C 10.4–22.6

Min temp (night)9.40 °C 6.50–10.4

Precipitation77.0 mm/mo 35.1–106

Air humidity61.7 % 51.0–64.3

Moisture balance25.8 mm/mo -92.1–32.3

Vapour deficit591 Pa 410–945

Wind speed3.20 m/s 1.90–4.20

Cloud cover43.9 % 32.4–59.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)