Aphrocallistes vastus

Schulze, 1886 · species

image placeholder — illustration coming later

Animalia/Porifera/Hexactinellida/Sceptrulophora/Aphrocallistidae/Aphrocallistes

At a glance

Occurrence records8 399

Data sources8

Biological traits2

DNA specimens14

eDNA detections5

Sources8 archives

Databases and archives Aphrocallistes vastus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 316 records↗

OBISOcean Biodiversity Information System4 083 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS8 399 records

Environmental DNA2 datasets · 1 countries5 detections

DNA & barcodingBOLD14 specimens

01Narrative

The cloud sponge (Aphrocallistes vastus) is a species of sea sponge in the class Hexactinellida. It is a deep-water reef-forming animal. The species was first described by F.E. Schulze in 1886.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphrocallistes vastus has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes11

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 566 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.47%

Haplotypes1

BIN1

Where individuals differ — all 11 variable positions, in barcode order

73Gvariable

74Cvariable

75Tvariable

76Gvariable

77Cvariable

156Cvariable

165Tvariable

266Cvariable

624Avariable

625Tvariable

639Tvariable

ATGATTAACCGATGACTATATTCAACAAACCACAAAGATATAGGAACTTTATACCTGATTTTTGGCGCCTTTGCTGCCTTCGCAGGAACA …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_010769 ↗ · 13 protein · 18 tRNA · 2 rRNA

ND4LATP6COX3ND2ND5ND1CYTBND4ND6ATP9ND3COX1COX2rnlrns

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type8 399 records

Wild obs. + sensor8 202

Museum / vouchered175

Other22

Range

Area of Occupancy AOO10 256 km²

Depth

0–200 m sunlit1 783

200–1000 m twilight2 110

1–4 km midnight98

>4 km abyssal0

median 217.1 m · max 2 560.3 m · 3 991 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1 524≤1 km 6 539≤10 km 8>10 km 2

8 073 georeferenced · 129 without coordinates

Open the mapobservation + sensor8 202

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 4≤1 km 40>10 km 2

46 georeferenced · 129 without coordinates

Open the institutions mapphysical evidence175

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Victoria, CA	53
Washington, US	14
CASlocation not on record	10
Santa Barbara Museum of Natural Historylocation not on record	8
Edmonton, CA	4
WoRMS Editorial Boardlocation not on record	4
Cambridge, US	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Toronto, CA	1

10 institutions · 99 of 175 vouchered records shown · 23 without an institution code

09Environmental DNA5 detections

Where the DNA of Aphrocallistes vastus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

Pacific Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.80 °C 8.80–8.80

Seasonal swing summer↔winter6.80 °C

Max temp (day)9.50 °C

Min temp (night)8.20 °C

Precipitation139 mm/mo

Air humidity62.7 %

Vapour deficit421 Pa

Cloud cover46.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphrocallistes vastus

At a glance

Sources8 archives

Habitat & environment2

At a glance

Record type8 399 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 399 records