Aphrissa neleis

(Boisduval, 1836) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pieridae/Aphrissa

At a glance

Occurrence records107

Data sources5

Biological traits0

DNA specimens8

eDNA detections0

Sources5 archives

Databases and archives Aphrissa neleis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility107 records↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF107 records

DNA & barcodingBOLD8 specimens

01Narrative

Aphrissa neleis is een vlindersoort uit de familie van de Pieridae (witjes), onderfamilie Coliadinae. Aphrissa neleis werd in 1836 beschreven door Boisduval.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphrissa neleis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.13%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 2 variable positions, in barcode order

235Cmostly conserved

562Gmostly conserved

AACATTATATTTTATTTTCGGAATTTGATCCGGAATAGTAGGAACTTCTTTAAGTCTTTTAATTCGAACAGAATTAGGAAATCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphrissa orbissame genus4.1%Rhabdodryas tritesame family6.2%Phoebis tritesame family6.2%Phoebis sennaesame family6.5%Phoebis marcellinasame family6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type107 records

Wild obs. + sensor101

Museum / vouchered6

Range

Area of Occupancy AOO228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 48≤1 km 17≤10 km 5>10 km 10

80 georeferenced · 21 without coordinates

Open the mapobservation + sensor101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 1≤10 km 1>10 km 3

5 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	4
Tartu, EE	1
Uniwersytet Jagiellońskilocation not on record	1

3 institutions · 6 of 6 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)