Aphonopelma hentzi

(Girard, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Theraphosidae/Aphonopelma

At a glance

Occurrence records5 360

Data sources9

Biological traits4

DNA specimens154

eDNA detections195

Sources9 archives

Databases and archives Aphonopelma hentzi's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 360 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI195 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics154 specimens↗

World Spider Trait DBMasaryk University4 traits · 3 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources4 traits

Occurrence & distributionGBIF5 360 records

Environmental DNA1 datasets · 1 countries195 detections

DNA & barcodingBOLD154 specimens

01Narrative

The Texas brown tarantula, also known as Oklahoma brown tarantula or Missouri tarantula (Aphonopelma hentzi), is one of the most common species of tarantula living in the Southern United States today. Texas brown tarantulas can grow to leg spans in excess of 4 in (10 cm) ,Oklahoma Brown Tarantula RET. Nov. 20, 2107 22:37 CST and weigh more than 3 oz as adults. Their bodies are dark brown, though shades may vary between individual tarantulas. The colors are more distinct after a molt, as with many arthropods.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesMichalik & Ramirez 2014Pekár 2014aPekár et al. 2012a

Predation1

Prey diversity3.17 mm

Ecology1

Circadian activitynocturnal

Anatomy1

Sperm transfer formcoenospermia

Defence1

Retreatburrow

05DNA & barcoding154 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphonopelma hentzi has left across the world's sequence archives.

At a glance

DNA specimens154

BINs3

Marker genes1

eDNA detections195

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P368 bp consensus153 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

5Amostly conserved

14Gmostly conserved

23Amostly conserved

29Tmostly conserved

53Cmostly conserved

74Amostly conserved

89Amostly conserved

119Amostly conserved

128Cmostly conserved

143Amostly conserved

149Cmostly conserved

161Tmostly conserved

167Gmostly conserved

179Gmostly conserved

184Cmostly conserved

209Gvariable

218Tmostly conserved

224Gmostly conserved

242Amostly conserved

260Amostly conserved

266Tmostly conserved

275Gmostly conserved

284Tmostly conserved

329Cmostly conserved

338Gmostly conserved

359Gmostly conserved

TTTTATCATCATTGACTGATGTAGGGGTTGGGGCTGGGTGAACTATTTATCCCCCTTTGTCTTCTTTTGTTGGACATTCTGGAGGTGGAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes29

BINs3

Most divergent pair14.4%

OtherN.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 360 records

Wild obs. + sensor5 310

Museum / vouchered50

Range

Area of Occupancy AOO12 524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 2 865≤1 km 600≤10 km 382>10 km 683

4 530 georeferenced · 780 without coordinates

Open the mapobservation + sensor5 310

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 5≤10 km 3>10 km 5

13 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	31
Chicago, US	14
Cambridge, US	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
DOI/FWS, Kenai National Wildlife Refugelocation not on record	1

5 institutions · 50 of 50 vouchered records shown

09Environmental DNA195 detections

Where the DNA of Aphonopelma hentzi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found195

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 195 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.1 °C 19.2–28.1

Seasonal swing summer↔winter19.8 °C

Max temp (day)33.8 °C 26.8–33.8

Min temp (night)22.7 °C 12.8–22.7

Precipitation79.1 mm/mo 9.50–79.1

Air humidity50.1 % 36.9–52.0

Moisture balance-80.6 mm/mo -164–-80.6

Vapour deficit1,898 Pa 1,072–1,898

Wind speed1.30 m/s 1.30–4.50

Cloud cover17.8 % 17.8–27.7

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphonopelma hentzi

At a glance

Sources9 archives

Predation1

Ecology1

Anatomy1

Defence1

At a glance

Record type5 360 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 5 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 360 records