Aphomia sociella

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Aphomia

At a glance

Occurrence records75 967

Data sources10

Biological traits0

DNA specimens157

eDNA detections161

Sources10 archives

Databases and archives Aphomia sociella's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility75 967 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI161 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics157 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS9 compounds

Occurrence & distributionGBIF75 967 records

Environmental DNA3 datasets · 17 countries161 detections

DNA & barcodingBOLD157 specimens

Genome at a glanceGoaT · NCBI≈682 Mbp

01Narrative

Aphomia sociella, also known as the bee moth and the bumble bee wax moth, is a small moth of the family Pyralidae (snout moths) and subfamily Galleriinae. Its body and forewings are typically reddish brown, tan, or dark green in color and females have a dark spot in the center of each forewing. The bee moth is native to Europe and are named "bee moths" because they seek out nests of bees and wasps to lay their eggs. Aphomia sociella are considered a pest because the bee moth larvae severely damage commercial bee hives. Bee moths are also studied for their unique mating ritual which includes a release of pheromones from both the male and the female along with an ultrasonic signal emitted through the male's tymbals.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition9 compounds

Compounds documented for Aphomia sociella across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Friedelane triterpenoids2

Oleanane triterpenoids2

Taraxerane triterpenoids2

Furocoumarins $ Simple coumarins1

Hydrocarbons1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(3R,4aR,6aR,6aS,8aR,12aR,14aR,14bR)-8a-(hydroxymethyl)-4,4,6a,6a,11,11,14b-heptamethyl-1,2,3,4a,5,6,8,9,10,12,12a,13,14,14a-tetradecahydropicen-3-ol	present	NPASS
(3R,4aR,6aR,6aS,8aS,12aS,14aR,14bR)-4,4,6a,6a,8a,11,11,14b-octamethyl-1,2,3,4a,5,6,8,9,10,12,12a,13,14,14a-tetradecahydropicen-3-ol	present	NPASS
(3R,4aS,6aR,6bS,8aR,11R,12S,12aS,14aR,14bR)-4,4,6a,6b,8a,11,12,14b-octamethyl-2,3,4a,5,6,7,8,9,10,11,12,12a,14,14a-tetradecahydro-1H-picen-3-ol	present	NPASS
(4R,4aS,6aR,6aS,6bR,8aR,12aS,14aS,14bR)-4,4a,6a,6b,8a,11,11,14a-octamethyl-2,4,5,6,6a,7,8,9,10,12,12a,13,14,14b-tetradecahydro-1H-picen-3-one	present	NPASS
[(3R,4aR,6aR,6bS,8aR,14aR,14bR)-4,4,6a,6b,8a,11,11,14b-octamethyl-1,2,3,4a,5,6,7,8,9,10,12,13,14,14a-tetradecahydropicen-3-yl] acetate	present	NPASS
delta-Amyrone	present	NPASS
Epi-Friedelinol	present	NPASS
Ethane	present	NPASS
Nodakenetic	present	NPASS

05DNA & barcoding157 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphomia sociella has left across the world's sequence archives.

At a glance

DNA specimens157

BINs4

Marker genes2

eDNA detections161

Countries17

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus149 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

10Tmostly conserved

40Amostly conserved

97Cmostly conserved

205Cvariable

214Amostly conserved

274Tmostly conserved

346Tmostly conserved

358Cmostly conserved

400Cmostly conserved

433Amostly conserved

562Cmostly conserved

616Cmostly conserved

625Tmostly conserved

628Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGATCTGGAATAGTAGGTACTTCTTTAAGTTTACTTATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes28

BINs4

Most divergent pair14.6%

EuropeN.AmericaOceaniaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mecistophylla amechanicasame family9.1%Cyana quentinisame order10.7%Chaograptis euchrysasame order11.1%Mazuca elegantissimasame order11.1%Aristotelia bifasciellasame order11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aphomia sociella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈681 660 367 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aphomia sociella0.68 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.4% BUSCO

08Occurrence & distribution

Record type75 967 records

Wild obs. + sensor72 359

Museum / vouchered3 375

Other233

Origin

Native75

Range

Area of Occupancy AOO56 660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 26 029≤1 km 7 519≤10 km 30 587>10 km 954

65 089 georeferenced · 7 270 without coordinates

Open the mapobservation + sensor72 359

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 1 058≤1 km 871≤10 km 720>10 km 445

3 094 georeferenced · 281 without coordinates

Open the institutions mapphysical evidence3 375

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	1 236
DanishLepidopterologicalSocietylocation not on record	726
Provincia di Livornolocation not on record	213
NHMOlocation not on record	186
NTNU-VMlocation not on record	99
Tartu, EE	67
Zürich, CH	62
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	57
SLU Artdatabankenlocation not on record	47
Salzburg, AT	43
Philadelphia, US	42
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	41
Kuopio, FI	40
Natural History Museum Rotterdamlocation not on record	39
Nijmegen, NL	30
ZMAAlocation not on record	29
CBDClocation not on record	23
Tallinn, EE	23
Stockholm, SE	18
North Carolina State University Insect Museumlocation not on record	15
BioFokuslocation not on record	12
Washington, US	11
neflocation not on record	10
New Haven, US	9
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
DABUHlocation not on record	7
Rovaniemi, FI	7
MZLUlocation not on record	6
Adam Mickiewicz University in Poznańlocation not on record	6
Durban Natural Science Museumlocation not on record	5
ZAF-UMUlocation not on record	5
SOVTlocation not on record	5
South Kensington, GB	4
Cornell University Insect Collectionlocation not on record	4
NCMGlocation not on record	4
Brussels, BE	2
University of Kaiserslauternlocation not on record	2
Mississippi State, US	2
NMBU:MINAlocation not on record	2
Landesmuseum Kärntenlocation not on record	1
ZSMlocation not on record	1
Toronto, CA	1
ASUlocation not on record	1
Research Collection of Gabriele Fiumilocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1
Natural History Museum, Londonlocation not on record	1

46 institutions · 3 155 of 3 375 vouchered records shown · 220 without an institution code

09Environmental DNA161 detections

Where the DNA of Aphomia sociella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found161

Studies independent surveys3

Countries17

Verifiable raw sequence linked17

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 161 detections have coordinates

Open the map17 countries0

0Mixed habitatPrivate garden1. Forest & WoodlandTemperate mixed forestUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 10.6–19.4

Seasonal swing summer↔winter21.5 °C

Max temp (day)19.4 °C 14.4–24.5

Min temp (night)11.2 °C 5.20–15.6

Precipitation83.2 mm/mo 45.4–115

Air humidity58.2 % 55.7–62.7

Moisture balance-44.2 mm/mo -68.3–2.90

Vapour deficit722 Pa 528–962

Wind speed3.20 m/s 2.30–4.80

Cloud cover41.0 % 32.2–50.8

CHELSA 1981–2010, ~9 km grid, at location & month of 155 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphomia sociella

At a glance

Sources10 archives

Compound class profile5 classes

Documented compounds9 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type75 967 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 46 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type75 967 records