Aphis vernoniae

Thomas, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphididae/Aphis

At a glance

Occurrence records59

Data sources4

Biological traits0

DNA specimens7

eDNA detections7

Sources4 archives

Databases and archives Aphis vernoniae's data was compiled from.

GBIFGlobal Biodiversity Information Facility59 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF59 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD7 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphis vernoniae has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 290 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

15Cmostly conserved

420Avariable

423Avariable

441Tvariable

636Gvariable

894Tvariable

ATAATAATAGGATGCCCAGATATATCATTTCCGCGATTAAATAATATTAGATTTTGATTATTACCACCATCATTAATAATAATAATTTGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.23%

Haplotypes3

BIN1

Most divergent pair0.39%

N.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type59 records

Museum / vouchered59

Range

Area of Occupancy AOO68 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 12≤1 km 4≤10 km 11>10 km 4

31 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence59

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	42
University Park, US	4
South Kensington, GB	4

3 institutions · 50 of 59 vouchered records shown · 9 without an institution code

09Environmental DNA7 detections

Where the DNA of Aphis vernoniae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 14.0–23.2

Seasonal swing summer↔winter29.8 °C

Max temp (day)26.5 °C 19.0–28.6

Min temp (night)16.2 °C 9.40–18.6

Precipitation139 mm/mo 131–144

Air humidity57.7 % 57.7–58.7

Moisture balance-27.0 mm/mo -50.3–28.4

Vapour deficit1,074 Pa 768–1,187

Wind speed3.70 m/s 3.50–3.70

Cloud cover38.3 % 36.4–43.8

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)