Aphis origani

Passerini, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphididae/Aphis

At a glance

Occurrence records38

Data sources5

Biological traits0

DNA specimens11

eDNA detections7

Sources5 archives

Databases and archives Aphis origani's data was compiled from.

GBIFGlobal Biodiversity Information Facility38 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF38 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD11 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphis origani has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes2

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

623Cvariable

AACTTTATACTTTTTATTTGGTATTTGATCAGGTATAATTGGTTCTTCTCTTAGAATTTTAATCCGATTAGAATTAAGTCAAATTAATTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphis taraxacicolasame genus2.1%Aphis plantaginissame genus2.1%Aphis crepidissame genus2.1%Aphis oestlundisame genus2.1%Aphis gossypiisame genus2.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type38 records

Wild obs. + sensor24

Museum / vouchered14

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 3≤1 km 10≤10 km 9

22 georeferenced · 2 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA7 detections

Where the DNA of Aphis origani was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 16.4–21.7

Seasonal swing summer↔winter17.2 °C

Max temp (day)22.6 °C 19.0–27.1

Min temp (night)15.8 °C 10.5–20.1

Precipitation42.1 mm/mo 19.2–84.4

Air humidity57.3 % 56.5–64.0

Moisture balance-50.3 mm/mo

Vapour deficit932 Pa 734–1,134

Wind speed3.20 m/s

Cloud cover40.0 % 32.1–47.3

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)