Aphis nerii

Boyer de Fonscolombe, 1841 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphididae/Aphis

At a glance

Occurrence records24 529

Data sources10

Biological traits0

DNA specimens543

eDNA detections737

Sources10 archives

Databases and archives Aphis nerii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility24 529 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI737 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics543 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS15 compounds

Occurrence & distributionGBIF24 529 records

Environmental DNA2 datasets · 33 countries737 detections

DNA & barcodingBOLD543 specimens

Genome at a glanceGoaT · NCBI499 Mbp

01Narrative

Aphis nerii, le puceron du laurier rose est une espèce d'insectes de l'ordre des hémiptères et de la famille des Aphididae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition15 compounds

Compounds documented for Aphis nerii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Naphthalenes and derivatives5

Germacrane sesquiterpenoids3

Guaiane sesquiterpenoids2

Cinnamic acids and derivatives $ Simple phenolic acids1

Furofuranoid lignans1

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Syringaresinol	present	NPASS
(3R)-1,3-dimethyl-9-[(2S,3R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,4-dihydro-1H-benzo[g]isochromene-4,7,10-triol	present	LOTUS
(3S,3aR,4S,6E,9R,10E,11aR)-4-hydroxy-3,6,10-trimethyl-9-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,8,9,11a-hexahydro-3H-cyclodeca[b]furan-2-one	present	NPASS
(3S,3aR,4S,6E,9R,10E,11aR)-9-hydroxy-3,6,10-trimethyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,8,9,11a-hexahydro-3H-cyclodeca[b]furan-2-one	present	NPASS
(3S,3aS,6E,9R,10E,11aS)-3,6,10-trimethyl-9-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,8,9,11a-hexahydro-3H-cyclodeca[b]furan-2-one	present	NPASS
(6-Acetyl-4,5-diacetyloxy-7-methylnaphthalen-2-yl) acetate	present	LOTUS
4-Hydroxy-3,5-dimethoxybenzaldehyde	present	NPASS
6-Hydroxymusizin	present	LOTUS
6-Hydroxymusizin 8-O-glucoside	present	LOTUS
7,10-dihydroxy-1,3-dimethyl-9-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1H-benzo[g]isochromen-4-one	present	LOTUS

05DNA & barcoding543 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphis nerii has left across the world's sequence archives.

At a glance

DNA specimens543

BINs1

Marker genes2

eDNA detections737

Countries33

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus533 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

593Cmostly conserved

TTTATATTTTTTATTTGGAATTTGATCAGGTATAATCGGATCTTCTCTTAGAATTTTAATTCGACTAGAATTAAGTCAAATTAATTCAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.16%

Haplotypes9

BIN1

Most divergent pair0.92%

N.AmericaAsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphis verbascisame genus6.1%Aphis canaesame genus6.3%Aphis viburniphilasame genus6.4%Aphis neospiraeaesame genus6.8%Aphis galiiscabrisame genus6.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aphis nerii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size498 780 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aphis nerii0.50 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 8 n = 4

Chromosome records8–82n range8median8mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 82×GoaT · Animal Chromosome Counts Database · GoaT · Animal Genome Size Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Animal Genome Size Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type24 529 records

Wild obs. + sensor23 935

Museum / vouchered594

Origin

Native3

Range

Area of Occupancy AOO60 116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 13 395≤1 km 2 496≤10 km 886>10 km 2 315

19 092 georeferenced · 4 843 without coordinates

Open the mapobservation + sensor23 935

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 30≤1 km 11≤10 km 165>10 km 14

220 georeferenced · 374 without coordinates

Open the institutions mapphysical evidence594

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	141
MWLRlocation not on record	115
Essig Museum of Entomologylocation not on record	109
New Zealand Arthropod Collectionlocation not on record	73
WIlocation not on record	23
University of Guelph, Centre for Biodiversity Genomicslocation not on record	16
DPIlocation not on record	14
Copenhagen, DK	9
UAclocation not on record	8
University Park, US	3
US	3
Mangilao, GU	1
Tasmanian Museum & Art Gallerylocation not on record	1

13 institutions · 516 of 594 vouchered records shown · 78 without an institution code

09Environmental DNA737 detections

Where the DNA of Aphis nerii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found737

Studies independent surveys2

Countries33

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 737 detections have coordinates

Open the map33 countries0

3. Shrubland | 3.5. Subtropical/Tropical Dry…Urban3. Shrubland|3.5. Subtropical/Tropical Dry S…4. Native Grassland | 4.5. Subtropical/Tropi…Bryophyllum pinnatum3. Shrubland | 3.6. Subtropical/Tropical Moi…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 16.6–25.5

Seasonal swing summer↔winter15.1 °C

Max temp (day)25.4 °C 20.9–30.2

Min temp (night)16.9 °C 11.0–21.2

Precipitation81.1 mm/mo 7.70–278

Air humidity58.4 % 47.4–70.9

Moisture balance-38.0 mm/mo -133–162

Vapour deficit993 Pa 698–1,506

Wind speed2.50 m/s 1.40–4.60

Cloud cover31.0 % 14.3–51.6

CHELSA 1981–2010, ~9 km grid, at location & month of 675 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphis nerii

At a glance

Sources10 archives

Compound class profile5 classes

Documented compounds15 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type24 529 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type24 529 records