Aphis glycines

Matsumura, 1917 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphididae/Aphis

At a glance

Occurrence records954

Data sources9

Biological traits0

DNA specimens703

eDNA detections698

Sources9 archives

Databases and archives Aphis glycines's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility954 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI698 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics703 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF954 records

Environmental DNA1 datasets · 9 countries698 detections

DNA & barcodingBOLD703 specimens

Genome at a glanceGoaT · NCBI≈324 Mbp

01Narrative

The soybean aphid (Aphis glycines) is an insect pest of soybean (Glycine max) that is exotic to North America. The soybean aphid is native to Asia. It has been described as a common pest of soybeans in China and as an occasional pest of soybeans in Indonesia, Japan, Korea, Malaysia, the Philippines, and Thailand. The soybean aphid was first documented in North America in Wisconsin in July 2000. Ragsdale et al. (2004) noted that the soybean aphid probably arrived in North America earlier than 2000, but remained undetected for a period of time. Venette and Ragsdale (2004) suggested that Japan probably served as the point of origin for the soybean aphid's North American invasion. By 2003, the soybean aphid had been documented in Delaware, Georgia, Illinois, Indiana, Iowa, Kansas, Kentucky, Michigan, Minnesota, Mississippi, Missouri, Nebraska, New York, North Dakota, Ohio, Pennsylvania, South Dakota, Virginia, West Virginia, and Wisconsin. Together, these states accounted for 89% of the 63600000 acre of soybean planted in the United States in 2007.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding703 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphis glycines has left across the world's sequence archives.

At a glance

DNA specimens703

BINs2

Marker genes2

eDNA detections698

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus413 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

AACTTTGTATTTTTTATTTGGTATTTGATCAGGAATAATTGGATCTTCACTTAGAATTTTAATTCGATTAGAATTAAGTCAAATTAATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.45%

Haplotypes10

BINs2

Most divergent pair7.6%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphis taraxacicolasame genus3.8%Aphis plantaginissame genus3.8%Aphis crepidissame genus3.8%Aphis confusasame genus3.8%Aphis gossypiisame genus3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_045236 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aphis glycines carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈323 986 452 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aphis glycines0.32 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.2% BUSCO

07Deep time~15.6 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin15.6 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type954 records

Wild obs. + sensor3

Museum / vouchered951

Range

Area of Occupancy AOO544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 133≤1 km 40≤10 km 259

432 georeferenced · 519 without coordinates

Open the institutions mapphysical evidence951

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	523
University of Guelph, Centre for Biodiversity Genomicslocation not on record	159
Mississippi State, US	9
Biodiversity Institute of Ontariolocation not on record	6
Paris, FR	2
Centre for Biodiversity Genomicslocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
University Park, US	1
Copenhagen, DK	1

9 institutions · 703 of 951 vouchered records shown · 247 without an institution code

09Environmental DNA698 detections

Where the DNA of Aphis glycines was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found698

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 698 detections have coordinates

Open the map9 countries0

GrasslandMixed habitatTemperate mixed forest1. Forest & Woodland|1.9. Subtropical/Tropic…14. Artificial - Terrestrial|14.1 Arable LandAgricultural

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 15.2–20.4

Seasonal swing summer↔winter26.4 °C

Max temp (day)24.6 °C 20.2–24.7

Min temp (night)15.5 °C 11.8–17.1

Precipitation86.6 mm/mo 80.4–98.9

Air humidity59.5 % 57.6–60.7

Moisture balance-27.6 mm/mo -47.2–-2.70

Vapour deficit909 Pa 685–969

Wind speed3.00 m/s 2.40–3.90

Cloud cover43.2 % 40.0–48.5

CHELSA 1981–2010, ~9 km grid, at location & month of 333 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)