Aphis epilobii

Kaltenbach, 1843 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphididae/Aphis

At a glance

Occurrence records103

Data sources5

Biological traits0

DNA specimens17

eDNA detections2

Sources5 archives

Databases and archives Aphis epilobii's data was compiled from.

GBIFGlobal Biodiversity Information Facility103 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF103 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD17 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphis epilobii has left across the world's sequence archives.

At a glance

DNA specimens17

BINs2

Marker genes2

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

106Cmostly conserved

115Tmostly conserved

151Cmostly conserved

157Cmostly conserved

242Cmostly conserved

250Tmostly conserved

268Gvariable

274Amostly conserved

439Cmostly conserved

451Tmostly conserved

505Cmostly conserved

542Cmostly conserved

547Tmostly conserved

586Tmostly conserved

625Gmostly conserved

643Tmostly conserved

646Cmostly conserved

AACTTTATATTTTTTATTTGGTATTTGATCAGGTATAATTGGATCATCATTAAGAATTTTAATTCGATTAGAATTAAGTCAAATTAATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.40%

Haplotypes3

BINs2

Most divergent pair2.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphis varianssame genus2.6%Aphis oenotheraesame genus3.2%Aphis rumicissame genus6.1%Aphis rubifoliisame genus6.3%Aphis illinoisensissame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type103 records

Wild obs. + sensor28

Museum / vouchered75

Range

Area of Occupancy AOO220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 21≤1 km 4≤10 km 3

28 georeferenced

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤1 km 12≤10 km 10

22 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence75

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Copenhagen, DK	37
Essig Museum of Entomologylocation not on record	14
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	10
MWLRlocation not on record	5
New Zealand Arthropod Collectionlocation not on record	5
WIlocation not on record	3

6 institutions · 74 of 75 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Aphis epilobii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)