Aphileta misera

(O.Pickard-Cambridge, 1882) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Aphileta

At a glance

Occurrence records1 480

Data sources8

Biological traits6

DNA specimens37

eDNA detections40

Sources8 archives

Databases and archives Aphileta misera's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 480 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

World Spider Trait DBMasaryk University6 traits · 24 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements24 literature sources6 traits

Occurrence & distributionGBIF1 480 records

Environmental DNA3 datasets · 7 countries40 detections

DNA & barcodingBOLD37 specimens

01Narrative

Aphileta misera is a species of dwarf spider in the family Linyphiidae. It is found in North America, Europe, and Russia (Siberia to Far East).Dean DA (2016). "Catalogue of Texas spiders". ZooKeys 570: 1-703.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 24 sources

Buchar & Růžička 2002Gajdoš et al. 2014Gajdoš & Svatoň 2001SLU 2020Henriksen & Hilmo 2015Harvey et al. 2017Liste France 2018Hyvärinen et al. 2019Bruun & Lissner 2019Martin 2012Kielhorn 2017Finch 2004Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Blick & Scheidler 2004Nährig et al. 2003Blick et al. 2016Řezáč et al. 2015Staręga et al. 2002Maelfait et al. 1998Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀2.35·♂2.25 mm

Predation1

Hunting guildsheet web weavers

Ecology4

Light 2open

Moisture 2very humid

Regional IUCN Red List categoryEndangered (EN)

Regional non-IUCN Red List categoryEndangered (2)

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphileta misera has left across the world's sequence archives.

At a glance

DNA specimens37

BINs2

Marker genes1

eDNA detections40

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

67Gmostly conserved

83Tmostly conserved

87Amostly conserved

94Tmostly conserved

105Cmostly conserved

132Tmostly conserved

201Tmostly conserved

234Tmostly conserved

270Cmostly conserved

276Gmostly conserved

280Cmostly conserved

285Gmostly conserved

294Tmostly conserved

300Tmostly conserved

303Amostly conserved

342Cmostly conserved

345Tmostly conserved

363Tmostly conserved

372Amostly conserved

411Amostly conserved

429Gmostly conserved

432Gmostly conserved

495Tmostly conserved

516Gmostly conserved

525Amostly conserved

558Gmostly conserved

564Amostly conserved

576Amostly conserved

615Cvariable

639Tmostly conserved

ACATTATATTTTATTTTTGGGGCCTGAGCTGCTATAGTAGGGACGGCGATAAGAGTTTTAATTCGAGTTGAATTAGGTCAAATTGGAAGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes4

BINs2

Most divergent pair4.5%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Saaristoa sammamishsame family7.8%Saaristoa abnormissame family8.7%Oreonetides filicatussame family11.3%Walckenaeria cuspidatasame family11.5%Grammonota ornatasame family11.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 480 records

Wild obs. + sensor1 103

Museum / vouchered377

Origin

Native1

Range

Area of Occupancy AOO2 632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 539≤1 km 250≤10 km 287

1 076 georeferenced · 27 without coordinates

Open the mapobservation + sensor1 103

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 44≤1 km 94≤10 km 77>10 km 16

231 georeferenced · 146 without coordinates

Open the institutions mapphysical evidence377

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	95
SLU Artdatabankenlocation not on record	26
Adam Mickiewicz University in Poznańlocation not on record	25
Brussels, BE	24
Cambridge, US	24
University of Guelph, Centre for Biodiversity Genomicslocation not on record	18
Akademia Pomorska w Słupskulocation not on record	18
Uniwersytet w Białymstokulocation not on record	10
Edmonton, CA	8
Copenhagen, DK	5
Tartu, EE	5
Zoologisches Museum Hamburglocation not on record	3
Albuquerque, US	3
Ekaterinburg, RU	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
University of Alberta Museums (UAM)location not on record	2
Rovaniemi, FI	2
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	2
Awka, NG	1
Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record	1
University of Tokyo, Department of Zoologylocation not on record	1
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
Prioksko-Terrasnyi Biosphere Reservelocation not on record	1
SNSB-Zoologische Staatssammlung Münchenlocation not on record	1
WIlocation not on record	1
Bonn, DE	1
Bavarian State Collection of Zoologylocation not on record	1
Chicago, US	1
Denver, US	1
Espace pour la vielocation not on record	1
ZSMlocation not on record	1
MBRPlocation not on record	1
South Kensington, GB	1

33 institutions · 289 of 377 vouchered records shown · 88 without an institution code

09Environmental DNA40 detections

Where the DNA of Aphileta misera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys3

Countries7

Verifiable raw sequence linked5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map7 countries0

ForestWetlandMixed habitatGrasslandBogGrass forbs

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.70 °C 3.50–16.7

Seasonal swing summer↔winter26.7 °C

Max temp (day)14.5 °C 6.50–21.3

Min temp (night)5.70 °C 1.00–12.7

Precipitation72.2 mm/mo 39.3–120

Air humidity59.0 % 55.6–63.5

Moisture balance-10.0 mm/mo -54.4–34.6

Vapour deficit539 Pa 315–791

Wind speed3.00 m/s 2.20–4.70

Cloud cover47.1 % 40.8–58.6

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphileta misera

At a glance

Sources8 archives

Morphometry1

Predation1

Ecology4

At a glance

Record type1 480 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 480 records