Aphilanthops frigidus

(F.Smith, 1856) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Crabronidae/Aphilanthops

At a glance

Occurrence records496

Data sources6

Biological traits0

DNA specimens7

eDNA detections1

Sources6 archives

Databases and archives Aphilanthops frigidus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility496 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF496 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD7 specimens

01Narrative

Aphilanthops frigidus is a species of wasp in the family Crabronidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphilanthops frigidus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.38%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 5 variable positions, in barcode order

43Amostly conserved

106Tvariable

115Tmostly conserved

200Gmostly conserved

271Cmostly conserved

AATATTGTATTTTATATTTGCAATTTGATCAGGAATTTTAGGAACAAGATATAGTTTAATAATTCGTTTAGAATTATCAAGACCAGGAAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphilanthops subfrigidussame genus8.2%Clypeadon haigisame family17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type496 records

Wild obs. + sensor348

Museum / vouchered148

Range

Area of Occupancy AOO1 304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 183≤1 km 52≤10 km 23>10 km 29

287 georeferenced · 61 without coordinates

Open the mapobservation + sensor348

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤1 km 34≤10 km 48>10 km 10

92 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence148

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	33
WIlocation not on record	29
Santa Cruz, US	21
Champaign, US	21
Universidad Católica de Manizaleslocation not on record	18
OSUClocation not on record	6
Vancouver, CA	5
US	5
ASUlocation not on record	3
Chicago, US	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

12 institutions · 146 of 148 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Aphilanthops frigidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 18.4–18.4

Seasonal swing summer↔winter26.9 °C

Max temp (day)21.0 °C

Min temp (night)16.5 °C

Precipitation91.0 mm/mo

Air humidity60.6 %

Moisture balance-53.7 mm/mo

Vapour deficit833 Pa

Wind speed5.00 m/s

Cloud cover51.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)