Aphilaenus nigripectus

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphrophoridae/Aphilaenus

At a glance

Occurrence records98

Data sources4

Biological traits0

DNA specimens8

eDNA detections8

Sources4 archives

Databases and archives Aphilaenus nigripectus's data was compiled from.

GBIFGlobal Biodiversity Information Facility98 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF98 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD8 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphilaenus nigripectus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P590 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.07%

Haplotypes1

BIN1

Where individuals differ — all 1 variable positions, in barcode order

216Tmostly conserved

TTTTTATTTGGAATTTGATCAGGAATAATTGGGACCACTCTTAGATTATTAATTCGGGTTGAATTGGGACAACCTGGATCATTTATTGGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Philaenarcys killasame family12.0%Philaenarcys bilineatasame family12.4%Philaenarcys spartinasame family12.4%Aphrophora permutatasame family14.4%Aphrophora maculosasame family14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type98 records

Wild obs. + sensor66

Museum / vouchered32

Range

Area of Occupancy AOO268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 4≤1 km 7≤10 km 1

12 georeferenced · 54 without coordinates

Open the mapobservation + sensor66

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 32 records without

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
NSMKlocation not on record	21
Iwate Prefectural Museumlocation not on record	11

2 institutions · 32 of 32 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Aphilaenus nigripectus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 18.9–21.6

Seasonal swing summer↔winter35.1 °C

Max temp (day)24.4 °C 22.4–24.8

Min temp (night)16.6 °C 15.0–18.2

Precipitation117 mm/mo 105–164

Air humidity66.4 % 66.1–68.0

Moisture balance-2.30 mm/mo -13.7–44.7

Vapour deficit815 Pa 717–859

Wind speed2.90 m/s 1.50–3.10

Cloud cover50.0 % 48.6–51.2

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)