Aphidoletes aphidimyza

Rondani, 1848 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Cecidomyiidae/Aphidoletes

At a glance

Occurrence records224

Data sources9

Biological traits0

DNA specimens43

eDNA detections175

Sources9 archives

Databases and archives Aphidoletes aphidimyza's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility224 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI175 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF224 records

Environmental DNA4 datasets · 11 countries175 detections

DNA & barcodingBOLD43 specimens

Genome at a glanceGoaT · NCBI≈191 Mbp

01Narrative

Aphidoletes aphidimyza, commonly referred to as the aphid midge, is a midge whose larvae feed on over 70 aphid species, including the green peach aphid. Aphidoletes aphidimyza

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphidoletes aphidimyza has left across the world's sequence archives.

At a glance

DNA specimens43

BINs2

Marker genes1

eDNA detections175

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

9Tmostly conserved

159Gmostly conserved

237Gmostly conserved

243Amostly conserved

411Gmostly conserved

519Gmostly conserved

577Cmostly conserved

591Amostly conserved

594Cmostly conserved

609Cmostly conserved

612Tmostly conserved

633Tmostly conserved

ACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCATTAAGAATATTAATTCGATTAGAATTAAGAACAATTTATAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.98%

Haplotypes6

BINs2

Most divergent pair1.7%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lasioptera achyranthiisame family9.1%Schizomyia galiorumsame family9.1%Asteromyia carboniferasame family9.3%Prodiplosis longifilasame family9.6%Cecidomyia pinisame family9.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aphidoletes aphidimyza carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈191 431 736 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Aphidoletes aphidimyza0.19 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type224 records

Wild obs. + sensor50

Museum / vouchered174

Range

Area of Occupancy AOO392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 20≤1 km 18≤10 km 7>10 km 4

49 georeferenced · 1 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 127≤1 km 2≤10 km 15>10 km 1

145 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence174

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
The University of Hawaii Insect Museumlocation not on record	15
NHMOlocation not on record	4
WIlocation not on record	1
Washington, US	1
Centre for Biodiversity Genomicslocation not on record	1

5 institutions · 22 of 174 vouchered records shown · 151 without an institution code

09Environmental DNA175 detections

Where the DNA of Aphidoletes aphidimyza was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found175

Studies independent surveys4

Countries11

Verifiable raw sequence linked23

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 175 detections have coordinates

Open the map11 countries0

1. Forest & WoodlandAgricultural14. Artificial - Terrestrial|14.1 Arable LandfarmTemperate mixed forest4. Native Grassland | 4.4. Temperate Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 14.5–20.4

Seasonal swing summer↔winter17.1 °C

Max temp (day)20.4 °C 18.2–25.7

Min temp (night)13.7 °C 10.0–16.2

Precipitation76.7 mm/mo 19.9–97.2

Air humidity60.1 % 56.9–62.2

Moisture balance-48.3 mm/mo -123–4.30

Vapour deficit731 Pa 665–1,016

Wind speed3.40 m/s 2.40–4.20

Cloud cover39.8 % 30.6–48.5

CHELSA 1981–2010, ~9 km grid, at location & month of 171 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)