Aphidius uzbekistanicus

Luzhetzki, 1960 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Aphidius

At a glance

Occurrence records146

Data sources6

Biological traits0

DNA specimens275

eDNA detections914

Sources6 archives

Databases and archives Aphidius uzbekistanicus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility146 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI914 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics275 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF146 records

Environmental DNA5 datasets · 23 countries914 detections

DNA & barcodingBOLD275 specimens

01Narrative

Aphidius uzbekistanicus is een insect dat behoort tot de orde vliesvleugeligen (Hymenoptera) en de familie van de schildwespen (Braconidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd door Luzhetzki in 1960.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding275 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphidius uzbekistanicus has left across the world's sequence archives.

At a glance

DNA specimens275

BINs1

Marker genes2

eDNA detections914

Countries23

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus269 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.17%

Haplotypes1

BIN1

AATTTTATATTTTATTTTTGGTATATGATCTGGAGTCTTAGGTTTATCAATAAGATTATTAATTCGTATAGAGTTAAGAGTTACTAGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphidius urticaesame genus5.5%Aphidius rhopalosiphisame genus5.6%Aphidius microlophiisame genus5.9%Aphidius funebrissame genus5.9%Aphidius tarsalissame genus6.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type146 records

Wild obs. + sensor9

Museum / vouchered137

Origin

Native5

Range

Area of Occupancy AOO120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤1 km 6≤10 km 1

7 georeferenced · 2 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 2≤10 km 2

4 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CIBIOlocation not on record	15
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
UVEG-ENVlocation not on record	4
Helsinki, FI	2
I.I. Schmalhausen Institute of Zoologylocation not on record	1

5 institutions · 29 of 137 vouchered records shown · 108 without an institution code

09Environmental DNA914 detections

Where the DNA of Aphidius uzbekistanicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found914

Studies independent surveys5

Countries23

Verifiable raw sequence linked286

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 914 detections have coordinates

Open the map23 countries0

Grassland1. Forest & Woodland|1.1 Boreal Forest14. Artificial - Terrestrial | 14.2 Pasturel…4. Native GrasslandMixed HabitatMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 13.6–23.8

Seasonal swing summer↔winter20.4 °C

Max temp (day)20.7 °C 16.8–28.8

Min temp (night)12.2 °C 9.90–16.5

Precipitation69.9 mm/mo 21.4–111

Air humidity59.3 % 48.7–61.9

Moisture balance-48.1 mm/mo -124–14.6

Vapour deficit762 Pa 610–1,519

Wind speed2.60 m/s 1.60–4.30

Cloud cover45.2 % 38.3–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 883 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)