Aphidius ribis

Haliday, 1834 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Aphidius

At a glance

Occurrence records24

Data sources5

Biological traits0

DNA specimens15

eDNA detections101

Sources5 archives

Databases and archives Aphidius ribis's data was compiled from.

GBIFGlobal Biodiversity Information Facility24 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI101 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF24 records

Environmental DNA4 datasets · 6 countries101 detections

DNA & barcodingBOLD15 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphidius ribis has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections101

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P613 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 59 variable positions, in barcode order

2Tmostly conserved

4Tmostly conserved

5Amostly conserved

7Amostly conserved

9Tmostly conserved

12Amostly conserved

15Tmostly conserved

16Tmostly conserved

17Tmostly conserved

18Gmostly conserved

19Gmostly conserved

20Gmostly conserved

21Amostly conserved

22Tmostly conserved

23Gmostly conserved

25Gmostly conserved

26Amostly conserved

27Tmostly conserved

28Cmostly conserved

30Gmostly conserved

31Gmostly conserved

32Tmostly conserved

33Amostly conserved

36Cmostly conserved

37Tmostly conserved

38Amostly conserved

39Gmostly conserved

40Gmostly conserved

41Gmostly conserved

43Tmostly conserved

44Amostly conserved

45Tmostly conserved

46Cmostly conserved

47Tmostly conserved

49Tmostly conserved

51Amostly conserved

52Gmostly conserved

53Amostly conserved

57Tmostly conserved

59Amostly conserved

60Amostly conserved

61Tmostly conserved

63Cmostly conserved

64Gmostly conserved

65Tmostly conserved

66Amostly conserved

67Tmostly conserved

69Gmostly conserved

70Amostly conserved

71Amostly conserved

72Cmostly conserved

73Tmostly conserved

215Gmostly conserved

344Cmostly conserved

345Tmostly conserved

398Tmostly conserved

401Gmostly conserved

464Gvariable

542Gmostly conserved

TTTTATATTTTATTTTTGGGATGTGATCTGGTATACTAGGGTTATCTATAAGATTATTAATTCGTATAGAACTTAGTATTACTGGTAGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes3

BIN1

Most divergent pair0.65%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphidius salicissame genus7.4%Aphidius arvensissame genus7.5%Aphidius balcanicussame genus7.6%Aphidius aquilussame genus7.8%Aphidius asiaticussame genus8.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type24 records

Wild obs. + sensor10

Museum / vouchered14

Origin

Native1

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤1 km 8≤10 km 2

10 georeferenced

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 4≤1 km 2≤10 km 2

8 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Helsinki, FI	2
NTNU-VMlocation not on record	2
neflocation not on record	2
I.I. Schmalhausen Institute of Zoologylocation not on record	1
Royal Saskatchewan Museumlocation not on record	1

6 institutions · 10 of 14 vouchered records shown · 4 without an institution code

09Environmental DNA101 detections

Where the DNA of Aphidius ribis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found101

Studies independent surveys4

Countries6

Verifiable raw sequence linked57

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 101 detections have coordinates

Open the map6 countries0

14. Artificial - Terrestrial|14.5 Urban AreasUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 13.4–17.0

Seasonal swing summer↔winter17.3 °C

Max temp (day)18.5 °C 15.7–20.7

Min temp (night)11.0 °C 8.80–13.4

Precipitation68.9 mm/mo 58.9–99.6

Air humidity60.8 % 59.5–63.0

Moisture balance-46.6 mm/mo -62.2–20.0

Vapour deficit664 Pa 600–754

Wind speed3.70 m/s 2.50–4.50

Cloud cover47.2 % 39.9–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 94 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)