Aphidius colemani

Viereck, 1912 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Aphidius

At a glance

Occurrence records157

Data sources8

Biological traits0

DNA specimens680

eDNA detections2 447

Sources8 archives

Databases and archives Aphidius colemani's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility157 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 447 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics680 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF157 records

Environmental DNA3 datasets · 30 countries2 447 detections

DNA & barcodingBOLD680 specimens

Genome at a glanceGoaT · NCBI98 Mbp

01Narrative

Aphidius colemani is een insect dat behoort tot de orde vliesvleugeligen (Hymenoptera) en de familie van de schildwespen (Braconidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd door Viereck in 1912. Binnen de tuinbouw sector wordt dit soort uitgezet in kassen voor het bestrijden van bladluis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding680 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphidius colemani has left across the world's sequence archives.

At a glance

DNA specimens680

BINs2

Marker genes2

eDNA detections2 447

Countries30

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus666 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

34Avariable

169Tmostly conserved

208Gmostly conserved

232Cmostly conserved

319Tmostly conserved

334Tmostly conserved

370Gvariable

436Cmostly conserved

511Tvariable

545Cvariable

565Tmostly conserved

628Tmostly conserved

649Cvariable

TTTATATTTTATTTTTGGTATATGATCAGGTATATTAGGTTTATCTATAAGTTTATTAATTCGTATGGAACTTAGAATTACAGGGACATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.83%

Haplotypes12

BIN1

Most divergent pair1.7%

AfricaOceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphidius urticaesame genus8.9%Aphidius salicissame genus8.9%Aphidius asiaticussame genus9.0%Aphidius longistigmussame genus9.3%Aphidius schimitschekisame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_069199 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrn16rrn12

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aphidius colemani carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size97 800 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Aphidius colemani0.10 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type157 records

Wild obs. + sensor20

Museum / vouchered137

Origin

Native8

Introduced39

Range

Area of Occupancy AOO220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 3≤1 km 10≤10 km 1>10 km 4

18 georeferenced · 2 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 8>10 km 1

9 georeferenced · 128 without coordinates

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
MWLRlocation not on record	32
CIBIOlocation not on record	23
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
UVEG-ENVlocation not on record	8
UAclocation not on record	7
New Zealand Arthropod Collectionlocation not on record	5
Landcare Research, New Zealand Arthropod Collectionlocation not on record	3
DPIlocation not on record	2
Laboratoire Biométrie et Biologie Evolutive, University Lyon 1location not on record	1
Australian National Fish Collectionlocation not on record	1

10 institutions · 92 of 137 vouchered records shown · 45 without an institution code

09Environmental DNA2 447 detections

Where the DNA of Aphidius colemani was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2 447

Studies independent surveys3

Countries30

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 447 detections have coordinates

Open the map30 countries0

4. Native Grassland | 4.6. Subtropical/Tropi…1. Forest & Woodland1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland | 1.5. Subtropical/Trop…8. Desert | 8.1. Hot Desert14. Artificial - Terrestrial

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 13.2–21.2

Seasonal swing summer↔winter11.3 °C

Max temp (day)22.0 °C 16.7–28.1

Min temp (night)11.8 °C 8.10–15.0

Precipitation17.0 mm/mo 2.40–81.1

Air humidity54.3 % 47.0–63.8

Moisture balance-135 mm/mo -159–-2.30

Vapour deficit832 Pa 551–1,331

Wind speed3.10 m/s 1.60–4.80

Cloud cover26.9 % 9.90–41.6

CHELSA 1981–2010, ~9 km grid, at location & month of 1 936 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)