Apherusa jurinei

(H.Milne Edwards, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Calliopiidae/Apherusa

At a glance

Occurrence records1 378

Data sources7

Biological traits4

DNA specimens23

eDNA detections24

Sources7 archives

Databases and archives Apherusa jurinei's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility788 records↗

OBISOcean Biodiversity Information System590 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS1 378 records

Environmental DNA3 datasets · 7 countries24 detections

DNA & barcodingBOLD23 specimens

01Narrative

Apherusa jurinei is een vlokreeftensoort uit de familie van de Calliopiidae. De wetenschappelijke naam van de soort werd in 1830 voor het eerst geldig gepubliceerd door Henri Milne-Edwards.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max31 m

Depth min9 m

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apherusa jurinei has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes2

eDNA detections24

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

112Cvariable

175Gvariable

211Gvariable

229Gvariable

268Avariable

430Gvariable

538Cmostly conserved

562Amostly conserved

610Tmostly conserved

631Avariable

643Amostly conserved

648Amostly conserved

CACTTTATATTTCATTCTAGGAGCCTGAGCAAGATTAGTAGGCACTTCTCTAAGTGTAATCATTCGAACTGAATTAAGAGGCCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.75%

Haplotypes4

BIN1

Most divergent pair1.5%

OtherEurope

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 378 records

Wild obs. + sensor373

Museum / vouchered808

Other197

Range

Area of Occupancy AOO1 552 km²

Depth

0–200 m sunlit46

200–1000 m twilight7

1–4 km midnight0

>4 km abyssal0

median 10 m · max 549.9 m · 53 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 313≤1 km 2≤10 km 34

349 georeferenced · 24 without coordinates

Open the mapobservation + sensor373

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 136≤1 km 118≤10 km 10>10 km 3

267 georeferenced · 541 without coordinates

Open the institutions mapphysical evidence808

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DASSHlocation not on record	72
Citadel Hill, GB	39
Bergen, NO	34
PNHSlocation not on record	19
Gothenburg, SE	13
CEFASlocation not on record	12
Institut Francais pour l'Etude de la Merlocation not on record	12
Brussels, BE	12
Stockholm, SE	11
Station Biologique de Roscoff (EDMO:521)location not on record	10
RBINS-Scientific Heritagelocation not on record	9
South Kensington, GB	8
486location not on record	8
Norwegian Institute of Marine Researchlocation not on record	7
Auckland, NZ	6
RWSlocation not on record	6
SLU Artdatabankenlocation not on record	6
Natural History Museum of the Iberian Peninsula - NatMIP ("Museu de História Natural da Península Ibérica")location not on record	4
ARMS-MBONlocation not on record	4
NTNU-VMlocation not on record	3
Museum für Naturkunde Berlin (Zoological Collections)location not on record	3
University of Oslo (UiO)location not on record	2
Goteborg Natural History Museumlocation not on record	2
Washington, US	1
The Atlantic reference Centrelocation not on record	1
Zoologisches Museum Hamburglocation not on record	1
Tromsø, NO	1

27 institutions · 306 of 808 vouchered records shown · 21 without an institution code

09Environmental DNA24 detections

Where the DNA of Apherusa jurinei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys3

Countries7

Verifiable raw sequence linked4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map7 countries0

Rocky shoreMarina; semi-industrial; 9.3 - Subtidal Loos…Industrial port; industrial; 9.4 - Subtidal …Long-Term Ecological Research Site; LHI (Low…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 5.80–18.0

Seasonal swing summer↔winter13.9 °C

Max temp (day)12.4 °C 6.70–20.2

Min temp (night)9.10 °C 4.90–16.0

Precipitation76.3 mm/mo 35.3–114

Air humidity62.8 % 62.1–65.3

Vapour deficit466 Pa 358–749

Cloud cover50.2 % 38.8–56.5

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Apherusa jurinei

At a glance

Sources7 archives

Habitat & environment2

Other traits2

At a glance

Record type1 378 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 378 records