Aphelopus serratus

Richards, 1939 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Dryinidae/Aphelopus

At a glance

Occurrence records127

Data sources6

Biological traits0

DNA specimens23

eDNA detections85

Sources6 archives

Databases and archives Aphelopus serratus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility127 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI85 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF127 records

Environmental DNA4 datasets · 7 countries85 detections

DNA & barcodingBOLD23 specimens

01Narrative

Aphelopus serratus is een vliesvleugelig insect uit de familie van de tangwespen (Dryinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1939 door Richards.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphelopus serratus has left across the world's sequence archives.

At a glance

DNA specimens23

BINs2

Marker genes1

eDNA detections85

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 75 variable positions, in barcode order

26Amostly conserved

32Amostly conserved

36Gmostly conserved

79Cmostly conserved

80Amostly conserved

83Amostly conserved

104Amostly conserved

110Cmostly conserved

125Amostly conserved

161Tmostly conserved

173Amostly conserved

179Tmostly conserved

188Tmostly conserved

194Gmostly conserved

210Cmostly conserved

212Tmostly conserved

215Gmostly conserved

221Amostly conserved

230Tmostly conserved

233Cmostly conserved

239Amostly conserved

251Gmostly conserved

263Amostly conserved

266Gmostly conserved

272Amostly conserved

285Cmostly conserved

287Tmostly conserved

288Tmostly conserved

290Gmostly conserved

291Tmostly conserved

293Gmostly conserved

296Amostly conserved

300Gmostly conserved

317Cmostly conserved

326Gmostly conserved

329Amostly conserved

359Amostly conserved

365Cmostly conserved

371Tmostly conserved

380Gmostly conserved

401Tmostly conserved

404Tmostly conserved

407Gmostly conserved

410Tmostly conserved

428Gmostly conserved

449Amostly conserved

454Tmostly conserved

458Gmostly conserved

467Tmostly conserved

472Gmostly conserved

476Gmostly conserved

477Gmostly conserved

478Tmostly conserved

486Tmostly conserved

491Tmostly conserved

497Tmostly conserved

515Tmostly conserved

554Tmostly conserved

560Amostly conserved

566Tmostly conserved

611Cmostly conserved

612Tmostly conserved

613Cmostly conserved

614Tmostly conserved

616Cmostly conserved

617Tmostly conserved

619Gmostly conserved

622Gmostly conserved

644Tmostly conserved

645Cmostly conserved

647Amostly conserved

648Cmostly conserved

649Amostly conserved

652Tmostly conserved

653Amostly conserved

CTTTGTATTTTTTATTTGCTATTTGAGCGGGAATAGTTGGTTCTTCATTAAGAGTTTTAATTCGATTAGAATTAAGTTCACCAGGTTTAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes3

BINs2

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphelopus querceussame genus16.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type127 records

Wild obs. + sensor34

Museum / vouchered93

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 15≤1 km 11≤10 km 8

34 georeferenced

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 60≤1 km 3

63 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence93

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	28
Trondheim, NO	16
Museo Nacional de Ciencias Naturales (CSIC)location not on record	15
SLU Artdatabankenlocation not on record	13
Stockholm, SE	7
BioFokuslocation not on record	4
Helsinki, FI	4
MZLUlocation not on record	4
Swedish Museum of Natural Historylocation not on record	2

9 institutions · 93 of 93 vouchered records shown

09Environmental DNA85 detections

Where the DNA of Aphelopus serratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found85

Studies independent surveys4

Countries7

Verifiable raw sequence linked64

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 85 detections have coordinates

Open the map7 countries0

UrbanStor eik.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 11.2–17.1

Seasonal swing summer↔winter17.8 °C

Max temp (day)18.4 °C 14.9–20.8

Min temp (night)10.9 °C 8.50–13.5

Precipitation67.8 mm/mo 54.5–101

Air humidity60.8 % 58.6–63.4

Moisture balance-32.4 mm/mo -66.1–19.8

Vapour deficit679 Pa 491–776

Wind speed3.50 m/s 2.40–4.30

Cloud cover48.5 % 39.8–56.6

CHELSA 1981–2010, ~9 km grid, at location & month of 85 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)