Aphelopus melaleucus

(Dalman, 1818) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Dryinidae/Aphelopus

At a glance

Occurrence records610

Data sources6

Biological traits0

DNA specimens165

eDNA detections205

Sources6 archives

Databases and archives Aphelopus melaleucus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility610 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI205 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics165 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF610 records

Environmental DNA4 datasets · 11 countries205 detections

DNA & barcodingBOLD165 specimens

01Narrative

Aphelopus melaleucus is een vliesvleugelig insect uit de familie van de tangwespen (Dryinidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1818 door Dalman.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding165 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphelopus melaleucus has left across the world's sequence archives.

At a glance

DNA specimens165

BINs9

Marker genes1

eDNA detections205

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus114 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 83 variable positions, in barcode order

3Gmostly conserved

4Tmostly conserved

30Tmostly conserved

33Amostly conserved

36Gmostly conserved

39Tmostly conserved

45Tmostly conserved

48Cmostly conserved

54Gmostly conserved

66Tmostly conserved

69Gmostly conserved

72Gmostly conserved

78Gmostly conserved

81Tmostly conserved

87Tmostly conserved

90Tmostly conserved

105Gmostly conserved

108Gmostly conserved

126Gmostly conserved

132Gmostly conserved

159Gmostly conserved

174Gmostly conserved

180Gmostly conserved

183Gmostly conserved

189Amostly conserved

195Gmostly conserved

213Amostly conserved

216Tmostly conserved

234Cmostly conserved

240Tmostly conserved

273Amostly conserved

276Tmostly conserved

285Amostly conserved

289Amostly conserved

291Amostly conserved

297Amostly conserved

300Amostly conserved

303Cmostly conserved

315Tmostly conserved

321Tmostly conserved

324Tmostly conserved

327Gmostly conserved

330Avariable

333Tmostly conserved

339Cmostly conserved

357Gmostly conserved

369Gvariable

378Amostly conserved

387Gmostly conserved

388Gmostly conserved

402Amostly conserved

408Gmostly conserved

415Gmostly conserved

423Amostly conserved

429Gmostly conserved

432Gmostly conserved

453Tmostly conserved

468Tmostly conserved

475Amostly conserved

478Gmostly conserved

482Gmostly conserved

483Amostly conserved

487Amostly conserved

501Gmostly conserved

510Gmostly conserved

514Gmostly conserved

516Amostly conserved

527Cmostly conserved

538Cmostly conserved

543Amostly conserved

549Amostly conserved

561Cmostly conserved

564Tmostly conserved

567Amostly conserved

573Tmostly conserved

621Gmostly conserved

624Gmostly conserved

627Amostly conserved

630Gmostly conserved

633Tmostly conserved

636Tmostly conserved

639Tmostly conserved

645Tmostly conserved

ATGTTATATTTTTTATTTGCTTTATGGGCTGGAATGGTTGGTTCTTCCTTAAGGTTATTAATTCGTTTGGAGTTAAGGTGTCCTGGTATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes25

BINs6

Most divergent pair11.3%

EuropeN.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphelopus albopictussame genus7.5%Aphelopus wushensissame genus12.4%Aphelopus querceussame genus12.6%Aphelopus camussame genus13.1%Aphelopus nivealissame genus14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type610 records

Wild obs. + sensor106

Museum / vouchered504

Range

Area of Occupancy AOO696 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 37≤1 km 23≤10 km 34

94 georeferenced · 12 without coordinates

Open the mapobservation + sensor106

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 310≤1 km 10≤10 km 11

331 georeferenced · 173 without coordinates

Open the institutions mapphysical evidence504

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	150
Trondheim, NO	102
BioFokuslocation not on record	50
Museo Nacional de Ciencias Naturales (CSIC)location not on record	42
SLU Artdatabankenlocation not on record	37
MZLUlocation not on record	21
Bavarian State Collection of Zoologylocation not on record	18
ZSMlocation not on record	15
CBDClocation not on record	12
Stockholm, SE	12
Paris, FR	9
Gothenburg, SE	9
Helsinki, FI	4
Natural History Museum, Londonlocation not on record	3
South Kensington, GB	3
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
SGAV-and-NHMDlocation not on record	1
Wellcome Sanger Institutelocation not on record	1
Metsähallituslocation not on record	1
MOLClocation not on record	1
DPPZlocation not on record	1
Honolulu, US	1

22 institutions · 495 of 504 vouchered records shown · 9 without an institution code

09Environmental DNA205 detections

Where the DNA of Aphelopus melaleucus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found205

Studies independent surveys4

Countries11

Verifiable raw sequence linked88

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 205 detections have coordinates

Open the map11 countries0

Farmland, coast and birch habitatUrban1. Forest & Woodland|1.4. Temperate ForestHay meadowFen edgepine forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 10.0–17.5

Seasonal swing summer↔winter18.3 °C

Max temp (day)17.5 °C 12.8–21.2

Min temp (night)10.2 °C 6.10–13.2

Precipitation71.1 mm/mo 52.4–117

Air humidity60.8 % 57.7–64.2

Moisture balance-17.1 mm/mo -52.3–48.1

Vapour deficit646 Pa 436–788

Wind speed2.70 m/s 2.20–4.90

Cloud cover45.0 % 38.1–57.2

CHELSA 1981–2010, ~9 km grid, at location & month of 205 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)