Aphelandra sinclairiana

Nees · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Aphelandra

At a glance

Occurrence records296

Data sources9

Biological traits16

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Aphelandra sinclairiana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility296 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF296 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Aphelandra sinclairiana est une espèce de plantes à fleurs de la famille des Acanthaceae. C'est une plante herbacée originaire du Panama et du Sud-Est du Costa Rica.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height6.22 m

Plant height max4 m

Life cycle & reproduction3

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Habitat & environment7

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)223 mg/g

Leaf n27.41 mg/g

Specific leaf area (SLA)29.34 mm²/mg

Wood density573 mg/cm³

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphelandra sinclairiana has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLGQ981668.1 ↗553 bpPanama · 2007

ACGT

AGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCA …

Aphelandra sinclairiana ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Aphelandra sinclairiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 143×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — McDade, L. A. 1984. Systematics and reproductive biology of the Central American species of the Aphelandra pulcherrima complex (Acanthaceae). Ann. Missouri Bot. Gard. 71(1): 104–165.

CCDB · ipcn-api-dl — Daniel, T. F. 2000. Additional chromosome numbers of American Acanthaceae. Syst. Bot. 25(1): 15–25.

CCDB · ipcn-api-dl — Daniel, T. F. 2000. Chromosome numbers of some Acanthaceae from Papua New Guinea. Austrobaileya 5(4): 651–659.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type296 records

Wild obs. + sensor118

Museum / vouchered178

Range

Area of Occupancy AOO668 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 51≤1 km 25≤10 km 15>10 km 5

96 georeferenced · 22 without coordinates

Open the mapobservation + sensor118

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 2≤1 km 3≤10 km 1

6 georeferenced · 172 without coordinates

Open the institutions mapphysical evidence178

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	99
National Biodiversity Institute, Costa Ricalocation not on record	25
Museo Nacional de Costa Rica (MNCR)location not on record	15
Auckland, NZ	3
Claremont, US	3
Denver, US	3
University of Stellenboschlocation not on record	3
Bronx, US	2
Mexico City, MX	2
San José, CR	2
Kew, GB	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Salvador, BR	2
Mexico City, MX	1
Chicago, US	1
Wlocation not on record	1
UFABClocation not on record	1
JBRJlocation not on record	1
Tampa, US	1
Santa Teresa, BR	1
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	1
INMAlocation not on record	1
ASUlocation not on record	1
CNF-UFHBlocation not on record	1
South Kensington, GB	1

25 institutions · 175 of 178 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Aphelandra sinclairiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)