Aphanostephus skirrhobasis

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Aphanostephus

At a glance

Occurrence records506

Data sources7

Biological traits9

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Aphanostephus skirrhobasis's data was compiled from.

GBIFGlobal Biodiversity Information Facility506 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF506 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 6

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphanostephus skirrhobasis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF118521.1 ↗624 bp

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGTGAACATGTTAAAACAACCATGCCAGGATGCGTCGAGCATCTGTTTGATCTTCCTGGCACACC …

Aphanostephus skirrhobasis internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aphanostephus skirrhobasis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Ploidydiploid inferred

Chromosome records6–142n range6median6mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 66×CCDB · ipcn-api-dl · CCDB · eflora · CCDB · book-fedorov

CCDB · ipcn-api-dl — Zhao, Z. & B. L. Turner. 1993. Documented chromosome numbers 1993: 3. Miscellaneous U.S.A. and Mexican species, mostly Asteraceae. Sida 15: 649–653.

CCDB · eflora

CCDB · book-fedorov — Turner, Crammer 1964

CCDB · book-fedorov — Turner, Crawmer 1964

CCDB · book-fedorov — Turner, Mabry 1964

2n 141×CCDB · book-fedorov

CCDB · book-fedorov — Smith E. B., Johnson 1964 ch

n 31×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Semple, J. C. 1980. In Chromosome number reports LXVII. Taxon 29: 357–358.

n 41×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Keil, D. J. & D. J. Pinkava. 1976. Chromosome counts and taxonomic notes for Compositae from the United States and Mexico. Amer. J. Bot. 63: 1393–1403.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type506 records

Wild obs. + sensor182

Museum / vouchered324

Range

Area of Occupancy AOO1 564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 87≤1 km 22≤10 km 4>10 km 19

132 georeferenced · 50 without coordinates

Open the mapobservation + sensor182

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 8≤1 km 26≤10 km 109>10 km 20

163 georeferenced · 161 without coordinates

Open the institutions mapphysical evidence324

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	79
Fort Worth, US	55
Lubbock, US	31
Denton, US	20
Texas Lutheran Universitylocation not on record	16
Albuquerque, US	15
BAYLUlocation not on record	13
Austin, US	11
Chongqing Museumlocation not on record	11
EL PASO, US	9
Bangkok, TH	8
Emporia, US	6
Stephenville, US	5
US	4
Phoenix, US	3
DOI/NPS, Colonial National Historical Parklocation not on record	3
Riverside, US	2
Bloomington, US	2
Chadron, US	2
San Angelo, US	2
CJBGlocation not on record	2
Burlington, US	2
DOI/NPS, Greenbelt Parklocation not on record	2
Montréal, CA	2
Saint Louis, US	2
Québec, CA	2
Clemson, US	1
Pittsburg, US	1
Lincoln, US	1
Tempe, US	1
Mexico City, MX	1
Stockholm, SE	1
University of Stellenboschlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Boise, US	1
Angwin, US	1
LDlocation not on record	1
Davis, US	1
University of Alberta Museumslocation not on record	1
Miami, US	1

40 institutions · 323 of 324 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Aphanostephus skirrhobasis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.