Aphanopus mikhailini

Parin, 1983 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Trichiuridae/Aphanopus

At a glance

Occurrence records26

Data sources8

Biological traits7

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Aphanopus mikhailini's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 records↗

OBISOcean Biodiversity Information System12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS26 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Aphanopus mikhailini is een straalvinnige vissensoort uit de familie van haarstaarten (Trichiuridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1983 door Parin. De soort staat op de Rode Lijst van de IUCN als niet bedreigd, beoordelingsjaar 2009.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length90 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max2 000 m

Depth min905 m

Vulnerability56

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphanopus mikhailini has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P660 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)1.1%

Haplotypes2

BIN1

Most divergent pair1.4%

Where individuals differ — all 9 variable positions, in barcode order

1Cvariable

2Avariable

3Avariable

50Cvariable

179Tvariable

215Cvariable

266Cvariable

431Gvariable

584Cvariable

CAACCCTATATCTGGTATTTGGTGCATGAGCTGGAATAGTAGGTACGGCCTTAAGCCTACTCATCCGAGCTGAGCTAAGCCAACCAGGCG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphanopus intermediussame genus3.5%Aphanopus carbosame genus3.7%Benthodesmus elongatussame family12.6%Pomatomus saltatrixsame order13.2%Cubiceps paradoxussame order13.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type26 records

Wild obs. + sensor1

Museum / vouchered25

Range

Area of Occupancy AOO40 km²

Depth

0–200 m sunlit0

200–1000 m twilight3

1–4 km midnight3

>4 km abyssal1

median 1 180 m · max 4 027.5 m · 7 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 3≤1 km 6≤10 km 3

12 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	6
FishBaselocation not on record	2
South African Institute for Aquatic Biodiversitylocation not on record	2
Zoologisches Museum Hamburglocation not on record	1
Sydney, AU	1

5 institutions · 12 of 25 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Aphanopus mikhailini was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 14.8–22.4

Seasonal swing summer↔winter5.50 °C

Max temp (day)22.0 °C 15.6–22.9

Min temp (night)20.8 °C 14.0–21.8

Precipitation53.2 mm/mo 47.0–101

Air humidity59.1 % 57.8–59.3

Vapour deficit1,040 Pa 723–1,099

Cloud cover30.3 % 27.6–31.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)