Aphanisticus pusillus

(Olivier, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Aphanisticus

At a glance

Occurrence records676

Data sources7

Biological traits1

DNA specimens7

eDNA detections6

Sources7 archives

Databases and archives Aphanisticus pusillus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility676 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF676 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD7 specimens

01Narrative

Aphanisticus pusillus (лат.) — вид жесткокрылых насекомых из семейства златок. Распространён в Швеции, Эстонии, Литве, Латвии, Великобритании, Дании, Бельгии, Нидерландах, Германии, Польше, Швейцарии, Австрии, Чехии, Словакии, Венгрии, Румынии, Украине, европейской России, Португалии, Испании, Франции, Италии, Боснии и Герцеговине, Албании, Греции, Марокко и Алжире. Кормовыми растениями для личинок являются Schoenus nigricans, Juncus, Luzula campestris и Carex.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (larval)herbivore

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphanisticus pusillus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

102Amostly conserved

631Gvariable

AACTTTATATTTTATTTTTGGAGCTTGATCCGGAATAGTGGGAACAGCATTAAGATTATTGATCCGAGCTGAATTAGGAAATCCTGATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.14%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphanisticus elongatussame genus12.9%Acupalpus pumilussame order17.0%Acupalpus carussame order17.2%Phrypeus rickseckerisame order17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type676 records

Wild obs. + sensor467

Museum / vouchered183

Fossil2

Other24

Origin

Native33

Range

Area of Occupancy AOO1 544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 170≤1 km 162≤10 km 126

458 georeferenced · 9 without coordinates

Open the mapobservation + sensor467

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 18≤1 km 48≤10 km 96>10 km 2

164 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence183

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	57
Brussels, BE	20
Zürich, CH	8
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	8
Bern, CH	6
Salzburg, AT	5
South Kensington, GB	5
Geneva, CH	4
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	4
Provincia di Livornolocation not on record	3
Uniwersytet Wrocławskilocation not on record	3
RBINS-Scientific Heritagelocation not on record	3
Paro, BT	2
ZSMlocation not on record	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Helsinki, FI	1
Natural History Museum Rotterdamlocation not on record	1
INCONNUlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Copenhagen, DK	1
Adam Mickiewicz University in Poznańlocation not on record	1

21 institutions · 138 of 183 vouchered records shown · 45 without an institution code

09Environmental DNA6 detections

Where the DNA of Aphanisticus pusillus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 12.6–17.0

Seasonal swing summer↔winter12.5 °C

Max temp (day)20.7 °C 16.8–20.7

Min temp (night)12.7 °C 8.00–12.7

Precipitation54.0 mm/mo 46.1–65.4

Air humidity60.9 % 58.8–60.9

Moisture balance-56.5 mm/mo -56.5–-39.5

Vapour deficit754 Pa 615–754

Wind speed4.10 m/s 3.50–4.30

Cloud cover41.6 % 36.9–41.6

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)