Aphanisticus emarginatus

(Olivier, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Buprestidae/Aphanisticus

At a glance

Occurrence records442

Data sources7

Biological traits0

DNA specimens4

eDNA detections2

Sources7 archives

Databases and archives Aphanisticus emarginatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility442 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF442 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD4 specimens

01Narrative

Aphanisticus emarginatus é uma espécie de insetos coleópteros polífagos pertencente à família Buprestidae. A autoridade científica da espécie é Olivier, tendo sido descrita no ano de 1790. Trata-se de uma espécie presente no território português.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphanisticus emarginatus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs3

Marker genes1

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

70Cvariable

133Cvariable

145Cvariable

169Avariable

181Amostly conserved

197Tmostly conserved

214Gmostly conserved

217Gmostly conserved

262Avariable

268Tmostly conserved

316Gmostly conserved

340Cvariable

346Tmostly conserved

400Amostly conserved

412Gmostly conserved

448Tmostly conserved

506Gmostly conserved

550Cmostly conserved

578Cmostly conserved

601Cvariable

622Tmostly conserved

646Tvariable

649Avariable

AACTTTATATTTCATTTTTGGTGCTTGATCTGGAATAGTAGGAACTGCATTAAGATTATTGATTCGAGCCGAGCTAGGAAACCCTGATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes3

BINs3

Most divergent pair3.0%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphanisticus distinctussame genus14.0%Aphanisticus elongatussame genus14.1%Chrysobothris dentipessame family16.9%Porotachys bisulcatussame order17.0%Elaphrus uliginosussame order17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type442 records

Wild obs. + sensor330

Museum / vouchered98

Fossil9

Other5

Origin

Native28

Range

Area of Occupancy AOO980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 50≤1 km 80≤10 km 121>10 km 14

265 georeferenced · 65 without coordinates

Open the mapobservation + sensor330

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 1≤1 km 12≤10 km 66>10 km 4

83 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence98

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	19
NCMGlocation not on record	13
Fribourg, CH	11
Vitoria, ES	9
Geneva, CH	6
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	5
Zürich, CH	4
Museum zu Allerheiligen Schaffhausenlocation not on record	2
Paris, FR	2
ZSMlocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
CBDClocation not on record	1

12 institutions · 76 of 98 vouchered records shown · 22 without an institution code

09Environmental DNA2 detections

Where the DNA of Aphanisticus emarginatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 17.9–17.9

Seasonal swing summer↔winter18.6 °C

Max temp (day)22.0 °C

Min temp (night)13.0 °C

Precipitation73.3 mm/mo

Air humidity57.6 %

Moisture balance-59.9 mm/mo

Vapour deficit872 Pa

Wind speed3.40 m/s

Cloud cover37.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)