Aphanes australis
Rydb. · speciesAt a glance
Occurrence records47 318
Data sources11
Biological traits45
DNA specimens16
eDNA detections9
Sources11 archives
Databases and archives Aphanes australis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility47 318 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics16 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources45 traits
Occurrence & distributionGBIF47 318 records
Environmental DNA1 datasets · 4 countries9 detections
DNA & barcodingBOLD · NCBI16 specimens
Genome at a glanceCCDB · GoaT2n = 16
01Narrative
De kleine leeuwenklauw is een eenjarige plant, die behoort tot de rozenfamilie (Rosaceae). De plant komt voor in Europa, Noordwest-Afrika en Noord-Amerika.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRY
Size & morphology16
Fruit length1 mm
Leaf length6.5 mm
Leaf length max8 mm
Leaf length min5 mm
Leaf mass2.8 mg
Leaf size70.75 mm²
Leaf width5.25 mm
⚠ sources differ — AusTraits: 5.25 mm · GIFT: 6 mm
Leaf width max6 mm
Leaf width min6 mm
Plant height0.058 m
⚠ sources differ — GIFT: 0.058 m · AusTraits: 0.08 m · LEDA: 0.065 m · TRY: 0.09 m
Plant height generative0.045 m
Plant height max0.2 m
Plant height min0.03 m
Seed mass0.283 mg
⚠ sources differ — TRY: 0.283 mg · LEDA: 0.241 mg · GIFT: 0.266 mg
Seed mass max0.29 mg
Seed mass min0.29 mg
Life cycle & reproduction13
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: unspecialized
Flowering endSep
Flowering startMay
Life spanannual
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number100
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf shapeobtriangular
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)208 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)17.91 mm²/mg
⚠ sources differ — TRY: 17.91 mm²/mg · LEDA: 22.9 mm²/mg · GIFT: 25.77 mm²/mg
Other traits1
Diaspore typefruit
05DNA & barcoding16 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphanes australis has left across the world's sequence archives.
At a glance
DNA specimens16
Marker genes6
GenBank sequences10
eDNA detections9
Countries4
The DNA barcodea real sequence read deposited for this species
AATGGTCCGGTGAAGTTTTCGGATCGCGGCGACGTGGCCGGTTCGCTGTCCGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGA …
Aphanes australis HIRO:HIRO-MY-166819 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL5★rbcLa★trnL-F★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Aphanes australis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidydiploid inferred
Chromosome records16–482n range16median16mode16records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1613×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · nw-europe-fl +6
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Montgomery, L., Khalaf, M.K., Bailey, J.P., Gornall, R.J. Watsonia 21: 365-368 (1997)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2686
CCDB · fl-europaea — Hjelmquist, 1959
CCDB · poland — Pogan E., Izmai?ow R. et al. 1983. Further studies in chromosome numbers of Polish Angiosperms. Part XVII. Acta Biol. Cracov. Ser. Bot. 25, 57-77.
CCDB · ipcn-api-dl — Lippert, W. & G. R. Heubl. 1988. Chromosomenzahlen von Pflanzen aus Bayern und angrenzenden Gebieten: [Teil 1]. Ber. Bayer. Bot. Ges. 59: 13–22.
CCDB · ipcn-api-dl — Montgomery, L., M. Khalaf, J. P. Bailey & K. J. Gornal. 1997. Contributions to a cytological catalogue of the British and Irish flora, 5. Watsonia 21: 365–368.
CCDB · book-northern-plants — Gue!j6nsson 1941.
CCDB · book-atlas-flowering-plants — Gudjonsson 1941
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Gustafsson, A. (1948). Polyploidy, life form and vegetative reproduction Hereditas 34: 1-22.
CCDB · CromoCat 2015 — Hjelmquist, H. (1959). Studien über Embryologie und Variabilität bei einigen Aphanes Arten. Bot. Not. 112: 17-64.
CCDB · CromoCat 2015 — Pogan, E. & R. Jzmailow. (1983). Further studies in chromosome numbers of Polish Angiosperms. Part XVII. Acta Biol. Cracov., Ser. Bot. 25: 57-77.
2n 483×CCDB · brit-fl · CCDB · nw-europe-fl · CCDB · kew
CCDB · brit-fl — Montgomery, L., Khalaf, M.K., Bailey, J.P., Gornall, R.J. Watsonia 21: 365-368 (1997)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2685
CCDB · kew — Bennett MD. 1972. Nuclear DNA content and minimum generation time in herbaceous plants. Proceedings of the Royal Society of London Series B-Biological Sciences. 181:109-135
n 83×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 643-663. Silvestre, S.Lagascalia17(1): 151-160(1993).
CCDB · ipcn-api-dl — Silvestre, S. 1993. Números cromosomáticos para la flora Española. 643--663. Lagascalia 17: 151–160.
CCDB · CromoCat 2015 — Silvestre, S. (1993). Números cromosómicos para la flora española. 643-663. Lagascalia 17(1): 151-160.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=0.196 ↗
08Occurrence & distribution
Record type47 318 records
Wild obs. + sensor45 472
Museum / vouchered1 817
Cultivated / captive4
Other25
Origin
Native8 233
Introduced1
Range
Area of Occupancy AOO69 248 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy26% within 1 km
≤100 m 3 839≤1 km 7 042≤10 km 30 793>10 km 67
41 741 georeferenced · 3 731 without coordinates
Open the mapobservation + sensor45 472
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy90% within 1 km
≤100 m 810≤1 km 185≤10 km 109>10 km 5
1 109 georeferenced · 708 without coordinates
Open the institutions mapphysical evidence1 817
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 4 records without
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions46 of 94 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| DBF-NHMDlocation not on record | 518 |
| LDlocation not on record | 249 |
| SLU Artdatabankenlocation not on record | 215 |
| Oskarshamn, SE | 71 |
| Görlitz, DE | 70 |
| WTUlocation not on record | 56 |
| Uniwersytet Wrocławskilocation not on record | 48 |
| BIO-UNIPIlocation not on record | 39 |
| MAlocation not on record | 39 |
| MeiseBGlocation not on record | 34 |
| Entomological Society of Latvialocation not on record | 34 |
| South Kensington, GB | 30 |
| Nijmegen, NL | 29 |
| Chapel Hill, US | 22 |
| Olocation not on record | 19 |
| València, ES | 16 |
| Vitoria, ES | 16 |
| Zürich, CH | 13 |
| Mlocation not on record | 13 |
| Vancouver, CA | 13 |
| Bergen, NO | 11 |
| Columbia, US | 11 |
| Corvallis, US | 10 |
| Barcelona, ES | 10 |
| Williamsburg, US | 8 |
| Salamanca, ES | 8 |
| BRNUlocation not on record | 7 |
| Pamplona, ES | 7 |
| John May Museum of Natural Historylocation not on record | 7 |
| Santiago de Compostela, ES | 7 |
| BFLlocation not on record | 7 |
| Norfolk, US | 5 |
| Tilburg, NL | 5 |
| GJOlocation not on record | 5 |
| Saint Louis, US | 5 |
| Pullman, US | 5 |
| Paris, FR | 5 |
| Zürich, CH | 4 |
| Rotorua, NZ | 4 |
| Universität Erlangen-Nürnberglocation not on record | 4 |
| BDBClocation not on record | 3 |
| Victoria, CA | 3 |
| Bangkok, TH | 3 |
| Xiamen, CN | 3 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 3 |
| CJBGlocation not on record | 3 |
| Madrid, ES | 3 |
| Berlin, DE | 3 |
| Provincia di Livornolocation not on record | 3 |
| CICYTEXlocation not on record | 3 |
| University of Stellenboschlocation not on record | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Wlocation not on record | 3 |
| Auckland, NZ | 3 |
| Bronx, US | 2 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| GZUlocation not on record | 2 |
| AUAlocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Frankfurt am Main | 2 |
| Portland, US | 2 |
| BClocation not on record | 2 |
| University of British Columbia, Herbariumlocation not on record | 2 |
| H-Meierottlocation not on record | 1 |
| Trondheim, NO | 1 |
| KMNlocation not on record | 1 |
| Kew, GB | 1 |
| Gijón, ES | 1 |
| Wellington, NZ | 1 |
| FLADlocation not on record | 1 |
| CJBNlocation not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Pamplona, ES | 1 |
| Cambridge, US | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| ER Hellerlocation not on record | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Jaén, ES | 1 |
| Knoxville, US | 1 |
| Valdosta State Universitylocation not on record | 1 |
| BSBIlocation not on record | 1 |
| PrivatHerblocation not on record | 1 |
| Lausanne, CH | 1 |
| Jackson, US | 1 |
| Bourges, FR | 1 |
| Fairfax, US | 1 |
| PRClocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 1 |
| Tuscaloosa, US | 1 |
94 institutions · 1 772 of 1 817 vouchered records shown · 44 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA9 detections
Where the DNA of Aphanes australis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found9
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 9 detections have coordinates
Open the map4 countries0
common in dry mown lawn with Veronica arvensisopen shady ground around picnic areain lawn under large deciduous tree
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.1 °C 8.80–17.0
Seasonal swing summer↔winter15.3 °C
Max temp (day)17.5 °C 11.3–21.8
Min temp (night)8.40 °C 5.20–12.2
Precipitation70.8 mm/mo 58.0–118
Air humidity61.1 % 56.8–63.2
Moisture balance-6.60 mm/mo
Vapour deficit585 Pa 426–847
Wind speed4.00 m/s
Cloud cover44.7 % 35.3–48.4
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.