Aphaereta aotea

Hughes & Woolcock, 1976 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Aphaereta

At a glance

Occurrence records199

Data sources6

Biological traits0

DNA specimens115

eDNA detections164

Sources6 archives

Databases and archives Aphaereta aotea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility199 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI164 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics115 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF199 records

Environmental DNA1 datasets · 9 countries164 detections

DNA & barcodingBOLD115 specimens

01Narrative

Aphaereta aotea is een insect dat behoort tot de orde vliesvleugeligen (Hymenoptera) en de familie van de schildwespen (Braconidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd door Hughes & Woolcock in 1976.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding115 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphaereta aotea has left across the world's sequence archives.

At a glance

DNA specimens115

BINs1

Marker genes1

eDNA detections164

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus110 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

332Gmostly conserved

TTTATATTTTTTATTTGGAATTTGGTCTGGTATAGTTGGATTATCAATAAGATTAATTATTCGTATAGAATTAGGTATACCTGGGTCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes5

BIN1

Most divergent pair0.92%

OceaniaAfricaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphaereta minutasame genus3.7%Aphaereta scaptomyzaesame genus5.8%Phaenocarpa picinervissame family7.8%Asobara tabidasame family8.7%Asobara albiclavasame family10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type199 records

Wild obs. + sensor2

Museum / vouchered197

Origin

Native94

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 10≤1 km 26≤10 km 13>10 km 6

55 georeferenced · 142 without coordinates

Open the institutions mapphysical evidence197

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MWLRlocation not on record	94
Auckland, NZ	64
New Zealand Arthropod Collectionlocation not on record	17
Museums Victorialocation not on record	6
Sydney, AU	6
Landcare Research, New Zealand Arthropod Collectionlocation not on record	5
UKY-HIClocation not on record	2

7 institutions · 194 of 197 vouchered records shown · 3 without an institution code

09Environmental DNA164 detections

Where the DNA of Aphaereta aotea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found164

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 164 detections have coordinates

Open the map9 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 12.2–22.4

Seasonal swing summer↔winter9.40 °C

Max temp (day)21.0 °C 15.6–26.8

Min temp (night)12.4 °C 7.10–19.4

Precipitation83.3 mm/mo 30.3–139

Air humidity62.8 % 55.1–67.9

Moisture balance-33.1 mm/mo -74.7–74.0

Vapour deficit760 Pa 499–1,050

Wind speed2.60 m/s 1.30–4.50

Cloud cover36.6 % 17.2–78.9

CHELSA 1981–2010, ~9 km grid, at location & month of 162 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)