Aphaenogaster senilis

Mayr, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Formicidae/Aphaenogaster

At a glance

Occurrence records919

Data sources9

Biological traits0

DNA specimens26

eDNA detections5

Sources9 archives

Databases and archives Aphaenogaster senilis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility919 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF919 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD26 specimens

Genome at a glanceGoaT · TreeOfSex2n = 32

01Narrative

Aphaenogaster senilis is a species of ant in the family Formicidae native to the western Mediterranean Basin.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphaenogaster senilis has left across the world's sequence archives.

At a glance

DNA specimens26

BINs6

Marker genes1

eDNA detections5

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 44 variable positions, in barcode order

1Tmostly conserved

8Cmostly conserved

23Cmostly conserved

47Amostly conserved

65Cmostly conserved

77Amostly conserved

80Amostly conserved

122Gvariable

123Gmostly conserved

130Gmostly conserved

164Gmostly conserved

170Cvariable

198Amostly conserved

200Cmostly conserved

224Tvariable

233Tmostly conserved

263Cmostly conserved

266Cmostly conserved

269Avariable

279Tvariable

281Cmostly conserved

287Tvariable

310Amostly conserved

314Amostly conserved

326Cmostly conserved

365Cvariable

407Tmostly conserved

431Amostly conserved

443Cvariable

500Tmostly conserved

512Cmostly conserved

521Cmostly conserved

536Tmostly conserved

542Amostly conserved

545Cmostly conserved

569Tmostly conserved

572Cvariable

575Amostly conserved

576Cmostly conserved

608Cmostly conserved

617Cmostly conserved

620Amostly conserved

623Amostly conserved

629Avariable

TTCTTTACTTTATTCTTGCTATCTGATCAGGTATAATTGGATCTTCAATAAGAATAATTATCCGCTTAGAATTAGGATCATGTAATTCAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes10

BINs6

Most divergent pair3.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphaenogaster spinosasame genus12.7%Aphaenogaster subterraneoidessame genus13.0%Messor capensissame family13.0%Aphaenogaster illyricasame genus13.6%Aphaenogaster gibbosasame genus13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Aphaenogaster senilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Chromosome records16–322n range32median32mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 323×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Lorite P, Palomeque T (2010) Karyotype evolution in ants (Hymenoptera: Formicidae), with a review of the known ant chromosome numbers. Myrmecological News 13: 89-102. ↗

2n 161×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type919 records

Wild obs. + sensor794

Museum / vouchered125

Origin

Native2

Range

Area of Occupancy AOO2 048 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 339≤1 km 72≤10 km 41>10 km 29

481 georeferenced · 313 without coordinates

Open the mapobservation + sensor794

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 50≤1 km 11≤10 km 9>10 km 10

80 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UGRlocation not on record	60
CASlocation not on record	20
Museu Nacional de História Natural e da Ciêncialocation not on record	16
Helsinki, FI	9
CEFElocation not on record	7
Barcelona, ES	3
South Kensington, GB	2
Cornell University Insect Collectionlocation not on record	1

8 institutions · 118 of 125 vouchered records shown · 7 without an institution code

09Environmental DNA5 detections

Where the DNA of Aphaenogaster senilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.6 °C 18.6–18.6

Seasonal swing summer↔winter16.9 °C

Max temp (day)24.0 °C

Min temp (night)12.7 °C

Precipitation53.7 mm/mo

Air humidity54.3 %

Moisture balance-59.1 mm/mo

Vapour deficit1,067 Pa

Wind speed2.50 m/s

Cloud cover44.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)