Aphaenogaster semipolita

(Nylander, 1856) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Formicidae/Aphaenogaster

At a glance

Occurrence records70

Data sources6

Biological traits0

DNA specimens34

eDNA detections25

Sources6 archives

Databases and archives Aphaenogaster semipolita's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility70 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF70 records

Environmental DNA1 datasets · 1 countries25 detections

DNA & barcodingBOLD34 specimens

01Narrative

Aphaenogaster semipolita is een mierensoort uit de onderfamilie van de Myrmicinae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1856 door Nylander.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphaenogaster semipolita has left across the world's sequence archives.

At a glance

DNA specimens34

BINs19

Marker genes1

eDNA detections25

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P647 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Where individuals differ — all 91 variable positions, in barcode order

10Amostly conserved

19Amostly conserved

22Cvariable

25Amostly conserved

29Amostly conserved

38Gmostly conserved

46Amostly conserved

52Tmostly conserved

55Tmostly conserved

59Cmostly conserved

61Avariable

73Tmostly conserved

85Amostly conserved

88Tmostly conserved

94Tmostly conserved

103Cmostly conserved

113Tmostly conserved

116Gmostly conserved

121Tmostly conserved

124Tmostly conserved

136Tmostly conserved

145Cmostly conserved

157Amostly conserved

160Cmostly conserved

172Avariable

175Cvariable

181Tmostly conserved

188Tmostly conserved

193Tmostly conserved

208Amostly conserved

220Amostly conserved

253Amostly conserved

256Tmostly conserved

259Tvariable

262Cmostly conserved

274Cmostly conserved

275Cmostly conserved

283Tmostly conserved

289Amostly conserved

303Amostly conserved

304Tmostly conserved

307Avariable

308Gmostly conserved

309Tmostly conserved

313Cmostly conserved

325Tmostly conserved

331Tmostly conserved

334Cvariable

337Cmostly conserved

346Gvariable

355Cmostly conserved

358Cmostly conserved

364Avariable

391Cmostly conserved

406Cvariable

409Amostly conserved

412Cmostly conserved

418Cmostly conserved

424Avariable

427Cmostly conserved

433Cmostly conserved

439Cmostly conserved

445Tmostly conserved

449Cmostly conserved

464Amostly conserved

465Tmostly conserved

468Amostly conserved

470Cmostly conserved

487Cmostly conserved

499Tvariable

508Cmostly conserved

511Cmostly conserved

517Cmostly conserved

520Cmostly conserved

533Cvariable

539Tmostly conserved

541Amostly conserved

544Tmostly conserved

553Amostly conserved

556Cvariable

559Tmostly conserved

572Cmostly conserved

577Tmostly conserved

580Tmostly conserved

607Tvariable

610Amostly conserved

613Amostly conserved

616Amostly conserved

619Avariable

622Amostly conserved

637Cmostly conserved

TTTTATTTTAGCTATTTGATCCGGAATAATTGGCTCTGCAATAAGAATAATTATTCGCCTAGAATTAGGATCTTGTAATTCATTAATTAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.1%

Haplotypes17

BINs19

Most divergent pair7.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphaenogaster campanasame genus6.3%Aphaenogaster simonelliisame genus6.3%Aphaenogaster ibericasame genus7.1%Aphaenogaster inermitasame genus7.5%Aphaenogaster balcanicasame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type70 records

Wild obs. + sensor20

Museum / vouchered50

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 8≤1 km 5≤10 km 4>10 km 1

18 georeferenced · 2 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	3
Cambridge, US	1

2 institutions · 4 of 50 vouchered records shown · 46 without an institution code

09Environmental DNA25 detections

Where the DNA of Aphaenogaster semipolita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map1 country0

harboroaks in open

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 12.9–18.6

Seasonal swing summer↔winter14.2 °C

Max temp (day)19.2 °C 17.4–20.8

Min temp (night)15.2 °C 7.30–17.2

Precipitation46.4 mm/mo 40.0–70.8

Air humidity60.0 % 57.6–62.1

Moisture balance-45.9 mm/mo

Vapour deficit810 Pa 708–893

Wind speed5.60 m/s

Cloud cover31.1 % 28.5–35.3

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)