Aphaenogaster fulva

Roger, 1863 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Formicidae/Aphaenogaster

At a glance

Occurrence records3 444

Data sources9

Biological traits0

DNA specimens14

eDNA detections0

Sources9 archives

Databases and archives Aphaenogaster fulva's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 444 records↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 444 records

DNA & barcodingBOLD14 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI411 Mbp

01Narrative

Aphaenogaster fulva is a species of ant in the family Formicidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aphaenogaster fulva has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P650 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

13Tmostly conserved

43Gmostly conserved

88Cmostly conserved

319Amostly conserved

325Gmostly conserved

343Amostly conserved

349Gmostly conserved

553Tmostly conserved

625Amostly conserved

631Tmostly conserved

646Cmostly conserved

AATTCTTTATTTTATTCTTGCTATTTGATCGGGAATAATTGGGTCCTCTATAAGAATAATTATTCGTTTAGAACTTGGATCATGTAACTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.31%

Haplotypes6

BIN1

Most divergent pair1.4%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aphaenogaster illyricasame genus9.8%Aphaenogaster caeciliaesame genus12.0%Aphaenogaster japonicasame genus12.1%Aphaenogaster subterraneoidessame genus12.2%Aphaenogaster cecconiisame genus12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Aphaenogaster fulva carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size410 760 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aphaenogaster fulva0.41 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Chromosome records18–362n range36median36mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 363×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Lorite P, Palomeque T (2010) Karyotype evolution in ants (Hymenoptera: Formicidae), with a review of the known ant chromosome numbers. Myrmecological News 13: 89-102. ↗

2n 181×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness94.7% BUSCO

08Occurrence & distribution

Record type3 444 records

Wild obs. + sensor1 254

Museum / vouchered2 190

Range

Area of Occupancy AOO4 720 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 608≤1 km 151≤10 km 32>10 km 90

881 georeferenced · 373 without coordinates

Open the mapobservation + sensor1 254

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 83≤1 km 78≤10 km 181>10 km 15

357 georeferenced · 1 833 without coordinates

Open the institutions mapphysical evidence2 190

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	930
CASlocation not on record	751
Cambridge, US	177
Champaign, US	90
EL PASO, US	63
Lake Placid, US	34
UDlocation not on record	30
Cornell University Insect Collectionlocation not on record	29
Chicago, US	29
OSUClocation not on record	25
Universidad Católica de Manizaleslocation not on record	16
ASUlocation not on record	8
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
CUlocation not on record	1
WIlocation not on record	1
SPC, MCZlocation not on record	1
University of Central Floridalocation not on record	1

17 institutions · 2 189 of 2 190 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aphaenogaster fulva

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type3 444 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 17 geolocated

Record type3 444 records