Apenes sinuata

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Apenes

At a glance

Occurrence records282

Data sources6

Biological traits0

DNA specimens36

eDNA detections33

Sources6 archives

Databases and archives Apenes sinuata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility282 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF282 records

Environmental DNA1 datasets · 1 countries33 detections

DNA & barcodingBOLD36 specimens

01Narrative

Apenes sinuata is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Apenes sinuata has left across the world's sequence archives.

At a glance

DNA specimens36

BINs2

Marker genes1

eDNA detections33

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

55Tmostly conserved

169Avariable

181Gvariable

232Cvariable

244Avariable

271Cvariable

277Tvariable

284Cvariable

286Tvariable

298Cvariable

319Cvariable

364Avariable

433Chighly variable

533Cvariable

547Tvariable

548Cvariable

562Avariable

595Cvariable

616Tvariable

625Amostly conserved

634Cvariable

AACATTATATTTTATTTTTGGTGCTTGAGCAGGAATAGTAGGAACTTCATTAAGTATATTAATTCGAGCTGAATTAGGTAATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes9

BINs2

Most divergent pair3.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apenes opacasame genus3.3%Apenes nebulosasame genus6.2%Apenes ivieisame genus6.5%Lionepha castasame family8.5%Lionepha australerasasame family8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type282 records

Wild obs. + sensor54

Museum / vouchered228

Range

Area of Occupancy AOO552 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 19≤1 km 19≤10 km 2>10 km 5

45 georeferenced · 9 without coordinates

Open the mapobservation + sensor54

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 52≤1 km 2≤10 km 7>10 km 1

62 georeferenced · 166 without coordinates

Open the institutions mapphysical evidence228

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
College Station, US	66
Tempe, US	64
Wuzhou, CN	25
University of Alberta Museums (UAM)location not on record	25
OSUClocation not on record	13
University of Central Floridalocation not on record	10
CUlocation not on record	6
Royal Saskatchewan Museumlocation not on record	3
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
University Park, US	2
Colorado State Universitylocation not on record	2
EWIClocation not on record	2
Provo, US	1
Decorah, US	1
Cambridge, US	1
Canadian Centre for DNA Barcodinglocation not on record	1
Albuquerque, US	1
Essig Museum of Entomologylocation not on record	1
UDlocation not on record	1
North Carolina State University Insect Museumlocation not on record	1

20 institutions · 228 of 228 vouchered records shown

09Environmental DNA33 detections

Where the DNA of Apenes sinuata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found33

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 33 detections have coordinates

Open the map1 country0

grasslandHerbaceousevergreenForestpastureHaywoodyWetlandsdeciduousForestmixedForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 20.4–27.5

Seasonal swing summer↔winter18.1 °C

Max temp (day)30.0 °C 26.3–33.0

Min temp (night)21.8 °C 16.4–23.4

Precipitation116 mm/mo 76.3–166

Air humidity59.2 % 54.4–64.0

Moisture balance-34.5 mm/mo -88.2–26.4

Vapour deficit1,309 Pa 1,003–1,497

Wind speed2.30 m/s 1.80–4.00

Cloud cover31.5 % 25.6–37.7

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)